malacology/staden-lg
1
0
Fork 0
Code Issues Pull requests Projects Releases Wiki Activity

init

Browse source
This commit is contained in:
kuoi 2021-12-04 05:07:58 +00:00
commit f8b7bfff1b
949 changed files with 253751 additions and 0 deletions
Show stats Download patch file Download diff file Expand all files Collapse all files

296
README.txt Normal file
View file

@ -0,0 +1,296 @@
General Information
(Not for the faint hearted)
30 September 1992
0. Introduction
---------------
This document contains information on the following subjects:
1. Installing the Staden Package on SPARCstations and DECstations
2. Installing the Staden Package on Other Machines
3. A Quick Guide to What's on the Release Tape
4. Overview of Data Flow During Sequence Assembly
5. Acknowledgements
1. Installing the Staden Package on SPARCstations and DECstations
-----------------------------------------------------------------
We are endeavouring to make the installation of the Staden Package as
quick and as easy as possible. In this current release we provide
statically linked sparc and mips executables as well as all sources.
To install the package:
1) Create a new directory for the software. You may have to log on as
superuser to do this.
% mkdir -p /home/BioSW/staden
2) Place the distribution tape in the drive and down load the package:
-sun-
% tar xvf /dev/rst0
...system messages...
-dec-
% tar xvf /dev/rmt0h
...system messages...
3) Users of the C Shell should add the following to his/her .login
file:
setenv STADENROOT /home/BioSW/staden
source $STADENROOT/staden.login
Users of the Bourne shell should add the following to their .profile
file:
STADENROOT=/home/BioSW/staden
export STADENROOT
. $STADENROOT/staden.profile
4) When the user next logs onto the work station the required
initialisation will automatically be performed, and the programs in
the Staden package can be run. Refer to the help/*.MEM files for
information on the various program. (eg help on xdap is in
help/DAP.MEM)
2. Installing the Staden Package on Other Machines
--------------------------------------------------
This is a little more difficult as you will need to remake all the
executables. Your system configuration may also mean that some changes
will need to be made, though hopefully only to makefiles. We provide
a script to aid installation (we hope!), but you may prefer to make
all the components manually.
To remake the Staden package you will require the following:
1) A Fortran77 compiler
2) An ANSI C compiler
3) X11 Release 4, including the Athena Widget libraries.
Start by following step 1 through 3 above, to unload the sources and
perform initialisations. Read the rest of this document and the other
help files. Look at the make files. Follow your nose!
If you have any problems or successes porting our software to other
platforms we would love to hear from you. We would also appreciate
receiving your general comments on the package.
Rodger Staden (principle author)
phone: +44 223 402389 email: rs@mrc-lmba.cam.ac.uk
post: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, U.K.
Simon Dear:
phone: +44 223 402266 email: sd@mrc-lmba.cam.ac.uk
post: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, U.K.
James Bonfield:
phome: +44 223 402499 email: jkb@mrc-lmba.cam.ac.uk
post: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, U.K.
3. A Quick Guide to What's on the Release Tape
----------------------------------------------
The directory structure on this tape is very important. Once set up, the Staden
package expects things to be in a predefined place. The root directory
of the structure is referred to by the environment variable
STADENROOT. Below this there should be at least the following:
1) bin/
All executable files and scripts should be in this directory.
$STADENROOT/bin is added to the search path by the script staden.login
(or staden.profile if you are using the Bourne Shell). Though you are
not forced to keep programs here, we find it is the simplest place to
keep them.
2) help/
All on-line help files are in this directory. Files of the form *.MEM
or *.mem are formatted ascii files and can be printed for personal
reference. The script staden.login sets up many environment variables
that refer to files in this directory, as well as modifying
XFILESEARCHPATH, which is used by X programs.
3) manl/
Local manual pages for ted and the staden package are in this directory. The
environment variable MANPATH is modified in staden.login to search
here too.
4) staden.login and staden.profile
These two files are scripts to set up environment variables required
by the Staden package. C Shell users should source staden.login from
their .login file, and Bourne Shell users should "source" staden.profile
from their .profile directory. See "Installing the Staden Package on
SPARCstations and DECstations", Part 3.
5) tables/
Configuration files for the Staden package are in this directory.
Various environment variables are set in staden.login to refer to
files in this directory.
Also of use are the following:
doc/ - Miscellaneous documentation.
userdata/ - Sample databases
src/ - program sources
ReleaseNotes - Notes on this and future releases
Staden_install - Installation script
SequenceLibraries - Notes on the use and installation of sequence libraries
Program Sources
---------------
All the program sources are found in the directories in $STADENROOT/src:
0) Misc/
Sources for a library of useful routines used by the staden package.
** Should be made before the programs in staden/ **
1) staden/
Sources for the Staden suite: mep, xmep, nip, xnip, nipl, pip, xpip,
pipl, sap (now superseded by dap), xsap (now superceded by xdap), sip,
xsip, sipl, dap, xdap, splitp1, splitp2, splitp3, gip and convert_project.
2) ted/
Sources for the trace display and sequence editing program ted.
3) abi/
Sample scripts and programs for handling ABI 373A data files.
4) alf/
Sample scripts and programs for handling Pharmacia A.L.F. data files.
Each directory has appropriate makefiles and README files.
4. Overview of Data Flow During Sequence Assembly
-------------------------------------------------
During a sequence assembly project the data can enter the sequence
assembly program from various routes (See Figure below).
Fluorescent Based
Sequencing Machine
Chromatogram Autoradiogram
ABI 373A Pharmacia A.L.F. |
| | |
| | |
| alfsplit |
| | |
+--------+--------+ |
| |
| |
ted (gip)
| |
+----------------+----------------+
|
|
xdap
Figure 1: Data Flow Through The Staden Suite
The Pharmacia A.L.F. data files in their original format consist of
one file for the (up to 10) samples that were on the gel. The program
alfsplit divides the file up so that each sample is in a file of
its own. From then on each gel reading can be handled individually.
Whether these files can be transferred back to the Compaq for
reprocessing is unknown.
All data from fluorescent based sequencing machines must pass through
the trace editing program ted. Ted allows data vector sequence at the
5' end and unreliable data at the 3' end to be clipped. The sequence
can be edited if desired, though we should stress that this is NOT
RECOMMENDED when used in conjunction with xdap. Ted translates all
Pharmacia A.L.F. uncertainty codes to a hyphen ("-") and outputs the
clipped sequence, along with additional information on the position
and content of cutoffs, to a file.
People wanting to use xdap with ABI and Pharmacia files, but who have
written their own trace clipping software should be aware that xdap
requires information to be passed in the sequence file so that
traces can be displayed. You may want to modify your software to be
compatible with our file format. The file consists of four parts:
1) Cut off information (Optional).
Format is ";%6d%6d%6d%-4s%-16s", where
field 1 = total number of bases called
2 = number of bases in the clipped sequence at the 5' end
3 = number of bases in the sequence in this file
4 = type of trace file.
"ALF " - Pharmacia A.L.F.
"ABI " - ABI 373A
"SCF " - SCF
"PLN " - Text only
5 = name of trace file.
2) Content of the clipped sequence at the 5' end (Optional).
The sequence can extend over several lines. Each line must
begin with ";<" and should be less than 80 characters in
length.
3) Content of the clipped sequence at the 3' end (Optional).
The sequence can extend over several lines. Each line must
begin with ";>" and should be less than 80 characters in
length.
4) Initial tags for the sequence (Optional)
Format is: ";;%4s %6d %6d %s\n", where
field 1 = type of tag to be created (see $STADTABL/TAGDB)
2 = position of tag
3 = length of tag
4 = annotation for tag (optional)
This feature is only available in the program xbap, which
at the time of writing is not yet being distributed with
the package.
5) The sequence, which can extend over several lines. Each
line should be less than 80 characters in length.
Here is a sample file:
; 660 55 450ABI a21d12.s1RES
;<AGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCGGTTCCTTCTGG
;<ATATC
;>-GATAAGCTGATTTG-TTT-CCATTATGGC-GGTTTGAGCCTC-G-GGTC
;>GACCACTCGGTGTGCCAGGAAGGGGTCTGAAATTGAATGGGTTATCACTA
;>GGCGACGTTT--TTTTCAAATTCCGGGCTAAATTTTACGGC-GGA-CGGT
;>TCCG-
;;COMM 1 10 M13mp18 subclone
CAAGACATTTTGAAATACTTGGAATACTGAATCCAAGATGTGGAACATTA
GACATATCCGTGTGCTCAACAATCGACATTTGATCCACTGATGAAAATGT
TCTTCGTTTAGAATTTCTCATAGCATCAGCCACTTTTGCATAATACTCGA
TTGAAGGTTCATGGAAAAAGCTGCGTAGAAGGCATGTCATTGTGCTTACG
AGCCATTTCGGATATCTTGTGAATTTAGCAGGAAGTTCTGTAACTGGTTG
GAATTCAAATATATCAGTTCTTCTTCCTGGATCTCGTCCTTTTTGCACTA
AAACCATTGCGATTGCATCCGGATTCTGAGTAAGAGCCACTACAGCTTTA
TGATACAGGCTCTTGTTATTCCTTTCGTGCTCGAATGGGAACTTTCCAGT
GGCACAAAAATATAGTGTACATCCCAGAGCCCATAGATCACATGTTCCGA
5. Acknowledgements
We would like to thank Applied Biosystems, Inc. and Pharmacia LKB
Biotechnology for their cooperation in agreeing to our routines
accessing the data files of their fluorescent sequencing machines.
373A sequence data file formats are the exclusive property of Applied
Biosystems, Inc.
ALF sequence data file formats are the exclusive property of Pharmacia
LKB Biotechnology, Inc.

190
ReleaseNotes Normal file
View file

@ -0,0 +1,190 @@
Release Notes for Staden Package 1992.3
---------------------------------------
Installation guide
------------------
The file doc/install.PS contain installation instructions.
Manual for the Staden Package
-----------------------------
There is now a 135 page manual on the Staden Package. It is currently
being distributed on a Word4 document on a Macintosh floppy disk.
Feedback and bug reports
------------------------
We welcome comments and suggestions on all aspects of the package and are
best contacted by email: rs@uk.ac.cam.mrc-lmb and sd@uk.ac.cam.mrc-lmb.
All abnormal terminations are bugs and we would like to be told of them
so they can be fixed. We recommend that you request an update at least once
a year as the package is evolving very rapidly.
Note due to popular demand we have decided to release new routines earlier
than in the past so please report bugs. The documentation for additions may
be sparser than before, or non-existent, but if there is something with which
you need help, email us.
Changes this release
--------------------
The assembly programs bap and xbap heve several new functions:
1. Find single stranded regions and try to fill them with "hidden"
data from the adjacent readings.
2. Find single stranded regions (includes ends of contigs) and
select primers and templates for double stranding them (joining
them).
3. Pre assembly screening for readings to find those that align
best. Optionally the hidden data can also be included in the
comparison (part of assembly function).
4. Find pairs of readings taken from opposite ends of the same
template (ie forward and reverse read pairs). List or plot their
positions.
5. A new function to check that readings have been assembled into
the correct positions. It aligns the hidden (previously termed "unused")
parts of readings with the consensus they overlap to see how well
they align. Poor alignments are reported.
6. During assembly each reading is now allowed to match up to 100
different places.
It might be guessed from the above that we are trying to improve our
ability to deal with the assembly of human data. Hence, also the next
addition.
A new experimental program (rep) for screening readings for Alu
sequences prior to assembly. The Alu containing segments are tagged
so they can be seen in the contig editor. A library of Alu sequences
is included in /tables/alus. The program is quite slow as it compares
each reading in both orientations with all of the Alu sequences (126
of them) in order to find the best match. Only time and more data will
tell how sensitive it is, and whether the current default score 0f 0.6
is "correct". BEWARE rep modifies the original reading files to include
the tag information. The only information is in /help/alu.help
A new program for extracting sets of sequences and their annotations
from the sequence libraries (lip). The only information is in
/help/lip.help
Changes to the xterm userinterface. These routines have been completely
rewritten. One addition is that now ?? in response to a question will
allow the user to get help on any function in a program. help is also
improved in the x version.
Changes last release
--------------------
DAP, XDAP have been replaced by BAP and XBAP (see below)
A new function for examining repeats has been added to NIP
A new repeat search has been added to SIP
Some outputs have been changed to produce FASTA format files
instead of PIR.
MEP now allows searches for motifs in which any 8 out of a string
of 20 can be switched on.
The manual has been updated.
Keyword and author searches on sequence libraries
All programs that use the libraries can now perform author
and keyword searches on all libraries (only nip did so before).
Postscript output
All graphics can now be saved to disk in postscript form by
use of a sub-option in "Redirect output".
Sequence assembly
BAP, XBAP replace DAP and XDAP. A program to convert DAP databases to BAP
databases (convert) is included. BAP databases can contain up to 8000 readings
and a consensus of 500,000 bases. A minor edit and recompilation will allow
up to 99,999 readings. The space is used more efficiently now as the databases
grow as the number of readings increases. Reading names can be 16 characters
in length. In addition:
1) Assembly is 4 times as fast as in the DAP.
2) Find internal joins is 5 times as fast and now brings up the join editor
with the two contigs in the correct orientation and aligned.
3) The assembly routines align pads better, plus a new automatic function can
also be used to align them prior to editing.
4) The contig editor has been greatly speeded up and its functionality
has been enhanced.
5) A routine for selecting oligos for primer walking is included.
6) A new routine allows batches of readings to be removed from a database.
7) We have also included routines for making SCF files, for getting the
sequence from SCF files, and one for marking the poor quality data in
readings. See the manual.
Sequence library formats
The standard sequence library indexing method is now that used on the
EMBL CD-ROM. The libraries (EMBL nucleotide and SWISSPROT protein) can be
left on the CD-ROM or copied to disk. We include in the package programs
for creating this type of index for EMBL updates, PIR in codata format,
NRL3D and GenBank. If the indexes are created all programs can read all
these libraries. Programs and scripts for this task are contained in the
directory indexseqlibs.
The keyword and author searches are particularly fast and the
keyword index is based on ALL text in the files - not just the keywords.
Feature table formats
The programs now use the new feature table format common to EMBL
and GenBank, but retain the old format for SWISSPROT which has not yet
changed.
For details of the above see file SequenceLibraries.
Pattern searches
Pipl and Nipl now have the facility to find only the best scoring
match for each sequence. The prompt is "? report all matches", so typing
only return means all matches will be shown and typing n means only the
highest scoring will be reported. It is particularly useful when employed
to create alignments. The corresponding help file has not been updated.
Also to incorporate long unix file names the pattern files no longer include
the annotation "filename".
Nip
Option 38 in nip "translate and list" has been removed as the the
more flexible routines of option 39 incorporate all its functionality. Many
options that relate to feature tables have been modified but their help files
are not yet up to date.
Vep
A program (vep) for automatic excising of vector (either
sequencing vector or cosmid vector) sequences from readings is now
included in the package.
Rodger Staden, Simon Dear, James Bonfield

420
SequenceLibraries Normal file
View file

@ -0,0 +1,420 @@
Notes on library handling
-------------------------
Contents of this document:
I) Introduction
II) Details of file organisation and use
III) Options currently available
IV) Installation guide
V) New feature table handling routines
VI) Indexing the sequence libraries
Section I Introduction
----------------------
Available sequence libraries
There are a number of different sequence libraries for nucleotide and protein:
PIR, GenBank, EMBL, Swissprot, and the Japanese Databank. Even after all the
years of their existence they still use different formats for their data. This
provides tedious and unrewarding work for software developers. Recently EMBL
and GenBank agreed a new and common way of writing their feature tables, which
is great help, although the rest of their format is different. Swissprot still
uses the old embl style feature table format and PIR yet another.
All the libraries distribute their data on magnetic tapes and EMBL and GenBank
have started to distribute on cdrom. The EMBL cdrom also contains Swissprot.
The GenBank and EMBL cdroms use different formats and have different contents.
The EMBL cdrom has useful indexes sorted alphabetically: those for entry name
and accession number, brief descriptions, keywords and freetext indexes are
already available and others are expected. These indexes point to the data for
each entry, and can be used to extract the data for any entry quickly.
Moving to unix
The VAX version of our package used PIR format which meant reformatting all
libraries other than PIR into that format. This required, at least
temporarily, having space for two copies of the libraries, and quite a lot of
cpu time. The software for doing this was provided by PIR, and is very VAX
specific and hence will not run under unix. For the unix version of our package
I have decided to use the EMBL cdrom format and its indexes as the primary
format. The current programs also support the use of PIR format libraries
without indexes - ie just the sequence and annotation files.
Indexing GenBank, EMBL updates, PIR and NRL3D
We include programs to create indexes for the above libraries. See below and
the README file in indexseqlibs. The programs can read all the above libraries
once the indexes are created. The indexing programs index the data in its
distributed form: WE DO NOT REFORMAT OR COPY THE LIBRARIES but simply create
indexes to the original files. Obviously this saves a lot of disk space, and
for those content to use only embl and swissprot from the cdrom, almost no disk
space is required. We havent tried it yet, but for genbank on cdrom, the only
extra disk space required would be for the indexes.
---------------------------------------------------------------------------
Section II Details of file organisation and use
-----------------------------------------------
The following strategy has been used to try to deal with alternate
and changing sequence library formats.
1) libraries are described at several levels:
a) the top level file is a list of available libraries which contains:
the library type, the name of the file containing the name of
each libraries individual files, and the prompt to appear on
the users screen: LTYPE LOGNAM PROMPT
b) the file containing the names of the libraries individual files
contains flags to define the file types: FTYPE LOGNAM
c) the individual library files
2) libary types handled:
a) EMBL/SWISSPROT in distributed format with cdrom index format
LTYPE = 'A'
b) GenBank in distributed format with cdrom index format LTYPE = 'C'
c) PIR/NRL3D in CODATA format with cdrom index format LTYPE = 'B'
d) PIR/NBRF .seq files can be read sequentially as "personal files
in PIR format" and do not appear in the list of available libraries.
e) FASTA format files can be read sequentially as "personal files
in FASTA format" and do not appear in the list of available
libraries.
3) EMBL, SWISSPROT and other libraries for which EMBL-style indexes have been
created
current file types:
A division.lookup
B entryname.index
C accession.target
D accession.hits
E brief description
F freetext.target
G freetext.hits
H author.target
I author.hits
Library list
level 1
|
|
-----------------------------------------------------------
| | |
lib 1 file list lib 2 file list lib 3 file list
level 2
| |
-------- ---------
level 3
file 1 file 1
file 2 file 2
. .
file n file n
---------------------------------------------------------------------------
Example
-------
Level 1
File name: sequence.libs
Environment variable: SEQUENCELIBRARIES
Contents:
A EMBLFILES EMBL nucleotide library ! in cdrom format
C GENBFILES GenBank nucleotide library!
A SWISSFILES SWISSPROT protein library! in cdrom format
B PIRFILES PIR protein library!
B NRL3DFILES NRL3D protein library!
Notes:
The libraries have types A,B,C. The logical names are EMBLLIBDESCRP and
SWISSLIBDESCRP, etc and the prompts are 'EMBL nucleotide library' and
'SWISSPROT protein library', etc. Anything to the right of a ! is a comment.
Level 2: the list of library files (using embl as an example)
File name: embl.files
Environment variable: EMBLFILES
Contents:
A EMBLDIVPATH/embl_div.lkp
B EMBLINDPATH/entrynam.idx
C EMBLINDPATH/acnum.trg
D EMBLINDPATH/acnum.hit
E EMBLINDPATH/brief.idx
F EMBLINDPATH/freetext.trg
G EMBLINDPATH/freetext.hit
H EMBLINDPATH/author.trg
I EMBLINDPATH/author.hit
Level 3: the sequence and annotation files (eg 15 for embl, 1 for swissprot).
Paths and file names:
EMBLPATH/bb.dat
EMBLPATH/fun.dat
EMBLPATH/inv.dat
EMBLPATH/mam.dat
EMBLPATH/org.dat
EMBLPATH/patent.dat
EMBLPATH/phg.dat
EMBLPATH/pln.dat
EMBLPATH/pri.dat
EMBLPATH/pro.dat
EMBLPATH/rod.dat
EMBLPATH/syn.dat
EMBLPATH/una.dat
EMBLPATH/vrl.dat
EMBLPATH/vrt.dat
All files from the division lookup file down are exactly as they appear on the
cdrom. The division lookup file relates numbers stored in the indexes to
actual division (or data) files stored on the disk. We rewrite it so the
directory structure and file names can be chosen locally. Its format is
I6,1x,A. An example is given below.
Division lookup file
File name: STADTABL/embl_div.lkp
Environment variable path EMBLDIVPATH
Contents:
1 EMBLPATH/bb.dat
2 EMBLPATH/fun.dat
3 EMBLPATH/inv.dat
4 EMBLPATH/mam.dat
5 EMBLPATH/org.dat
6 EMBLPATH/patent.dat
7 EMBLPATH/phg.dat
8 EMBLPATH/pln.dat
9 EMBLPATH/pri.dat
10 EMBLPATH/pro.dat
11 EMBLPATH/rod.dat
12 EMBLPATH/syn.dat
13 EMBLPATH/una.dat
14 EMBLPATH/vrl.dat
15 EMBLPATH/vrt.dat
---------------------------------------------------------------------------
Section III Options currently available
---------------------------------------
Facilities currently offered in nip,pip,sip,nipl,pipl,sipl:
Get a sequence by knowing its entry name
Get a sequences' annotation by knowing its entry name
Get an entry name by knowing its accession number
Search the freetext index
Search the author index
Facilities currently offered in nipl,pipl,sipl:
Search whole library
Search only a list of entry names
Search all but a list of entry names
Outline of each type of operation
Looking for an entry by name: the programs will open the library description
file and read the names of its files and their file types. Then they will open
the entrynam.idx file, and find the sequence offset, annotation offset and
division number. Then open the division lookup file, find the file name for the
division required, open that file, seek to the required byte and get the data.
Looking for an entry by accession number: the programs will open the library
description file and read the names of its files and their file types. Then
they open the acnum.trg and acnum.hit files. The acnum.trg file is read to find
the accession number and a pointer to the acnum.hit file and the number of
hits. That file is read and the corresponding entry names displayed. At
present no further action is performed, although I expect to list out the
titles for the entries found.
Searching the whole of a library: the programs will open the library
description file and read the names of its files and their file types. Then
they open the division lookup file, read the names and numbers of the sequence
files, open all of them, then open the entryname file. Then the library is
processed sequentially by reading the entry names, their sequence offsets and
division numbers from the entry names file, and then the sequence from the
appropriate data file.
Searching the whole of a library using a list of entry names to include: the
programs will open the library description file and read the names of its files
and their file types. Then they open the division lookup file, read the names
and numbers of the sequence files, open all of them, then open the entryname
file. Then the library is processed by reading the list of entry names and
finding the names in the entry names file to get their sequence offsets and
division numbers, and then the sequence from the appropriate data file. It will
stop when it reaches the end of the list of entry names. The list of entry
names can be in any order.
Searching the whole of a library using a list of entry names to exclude: the
programs will open the library description file and read the names of its files
and their file types. Then they open the division lookup file, read the names
and numbers of the sequence files, open all of them, then open the entryname
file. Then the library is processed sequentially by reading the list of entry
names, reading the next entry in the entry names file to make sure it does not
match, then getting the sequence offsets and division numbers, and then the
sequence from the appropriate data file. If a the next name matches the name on
the list of entry names, it will be skipped, and the next name to exclude read.
If the list of excluded names is finished the rest of the library is searched
sequentially. The list of entry names must be in the same order as those in the
library (ie sorted alphabetically).
Searching a whole library using a PIR format file is performed by reading it
sequentially. If as list of entry names is used it must be in the same order as
the entries in the library file.
---------------------------------------------------------------------------
Section IV Installation guide
-----------------------------
EMBL CDROM
The data can be left on the cdrom or copied to hard disk. The files
staden.login and staden.profile source the file $STADTABL/libraries.config.csh
and $STADTABL/libraries.config.sh respectively. Refer to this file to see what
is required to install, add or move a sequence library that you want to be used
by the programs.
Other libraries (PIR, Genbank, EMBL updates)
Create the indexes then edit the files that tell the programs where the data is
stored. The files staden.login and staden.profile source the file
$STADTABL/libraries.config Refer to this file to see what is required to
install, add or move a sequence library that you want to be used by the
programs.
------------------------------------------------------------------------------
Section V New feature table handling facilities
-----------------------------------------------
As mentioned above EMBL and GenBank have recently introduced new feature tables
for annotating the sequences. They are a great improvement on the previous ones
and, among other things, now permit correct translation of spliced genes.
Various options within nip have been added or modified to take advantage of
these changes. The routine to translate DNA to protein and write the protein
to disk now gives correct results for spliced genes. The routine to translate
DNA to protein and display the two together now gives correct translations
except for the amino acids spanning intron/exon junctions. The routine to plot
maps from feature tables can use the new style. The open reading frame finding
routine writes out its results in the new style. The routine that finds open
reading frames and writes their translations to disk also writes a title in the
form of a new style feature table entry. The feature table format output from
the pattern searches in nip also uses the new style.
----------------------------------------------------------------------------
Section VI Indexing the sequence libraries
--------------------------------------------
We handle EMBL, SwissProt, and GenBank in their distributed format, plus
PIR and NRL3D in codata format. All programs and scripts are in directory
indexseqlibs.
Currently we produce entryname index, accession number index freetext index,
and brief index (brief index contains the entry name the primary accession
number the sequence length and an 80 character description).
To produce any of the indexes requires the creation of several intermediate
files and the indexing programs are written so that the intermediate files
are the same for all libraries. This means that only the programs that read
the distributed form of each library need to be unique to that library, and
all the other processing programs can be used for all libraries.
However even the though the indexes have the same format, programs (like nip)
that read the libraries need to treat each library separately because their
actual contents are written differently.
Making the entry name index
---------------------------
Common program entryname2
EMBL emblentryname1
SwissProt emblentryname1
GenBank genbentryname1
PIR pirentryname1
NRL3D pirentryname1
Making the accession number index
---------------------------------
Common programs access2 access3 access4
EMBL emblaccess1
SwissProt emblaccess1
GenBank genbaccess1
PIR piraccess1 piraccess2
NRL3D No accession numbers
Making the brief index
----------------------
Common program title2
EMBL embltitle1
SwissProt embltitle1
GenBank genbtitle1
PIR pirtitle1 pirtitle2 (pir3 has no accession numbers)
NRL3D pirtitle2
Scripts
-------
emblentryname.script
emblaccession.script
embltitle.script
swissentryname.script
swissaccession.script
swisstitle.script
genbentrynamescript
genbaccession.script
genbtitle.script
pirentryname.script
piraccession.script
pirtitle.script
nrl3dentryname.script
nrl3dtitle.script

453
Staden_install-alpha Normal file
View file

@ -0,0 +1,453 @@
#! /bin/csh -f
#
# staden_install - version 2.4
#
# This is a prototype installation program.
#
# 9 March 1992
# Modified for installation on Sun, Alliant, etc
# No longer install 2rs
#
# 20 November 1992
# Now includes convert, cop, frog, getMCH and scf
#
# 25 November 1992
# SGI supported
#
# 19 May 1993
# DEC Alpha, Solaris supported
#
# Written by sd@uk.ac.cam.mrc-lmb
#
# prelim
set prog = $0 ; set prog = $prog:t
# Machines supported: al sun dec sgi alpha solaris
#set MACHINE = `echo $prog | sed 's/.*-//'`
set MACHINE = alpha
# For local (MRC-LMB) setup only
#set LOCAL = `echo $prog | awk '/local/{print "YES";exit;}{print "NO";}'`
set LOCAL = NO
echo ""
echo -n "Staden Package installation procedure - "
switch (${MACHINE})
case "al":
echo "Alliant FX/2800 Concentrix version"
set MAKE = "make -sk"
breaksw
case "sun":
echo "SunOS version"
set MAKE = "make -sk"
breaksw
case "dec":
echo "DEC Ultrix (mips) version"
set MAKE = "gmake -sk"
breaksw
case "sgi":
echo "Silicon Graphics Iris version"
set MAKE = "gmake -sk"
breaksw
case "alpha":
echo "DEC Alpha OSF/1 version"
set MAKE = "gmake -sk"
breaksw
case "solaris":
echo "Solaris version"
set MAKE = "make -sk"
breaksw
default:
echo "Panic. Unknown version"
exit 1
endsw
echo ""
echo "* starting initialization...please wait."
echo ""
# Binary fork of source directory
if ($LOCAL == "YES") then
set DIR_BINARIES = ${MACHINE}-binaries
set DIR_PROGS = ${MACHINE}-bin
else
set DIR_BINARIES = .
set DIR_PROGS = bin
set MAKE = "$MAKE -f makefile-${MACHINE}"
endif
init:
# Set useful shell variables
set YES="YES";
set NO="NO"
# set/unset some .cshrc envs.
unset noclobber
set noglob
# set interrupt trap
onintr end_failure
# Make dir command
set MKDIR = "mkdir"
# Copy command
set CP = "cp -p"
# Install command
#set INSTALL = "install"
#set INSTALL = "mv"
set INSTALL = "cp"
# Set up default responses
set DEF_STADEN_ROOT = `pwd`
set DEF_REQ_NONX = "$YES"
set DEF_REQ_X = "$YES"
set DEF_REQ_TED = "$YES"
set DEF_REQ_MISC = "$YES"
# directories
set DIR_SRC = $DEF_STADEN_ROOT/src
set DIR_BIN = $DEF_STADEN_ROOT/$DIR_PROGS
set DIR_MISC = $DIR_SRC/Misc
set DIR_STADEN = $DIR_SRC/staden
set DIR_TED = $DIR_SRC/ted
set DIR_ABI = $DIR_SRC/abi
set DIR_ALF = $DIR_SRC/alf
set DIR_BAP = $DIR_SRC/bap
set DIR_OSP = $DIR_SRC/bap/osp-bits
set DIR_CONVERT = $DIR_SRC/convert
set DIR_COP = $DIR_SRC/cop
set DIR_FROG = $DIR_SRC/frog
set DIR_GETMCH = $DIR_SRC/getMCH
set DIR_SCF = $DIR_SRC/scf
main:
preamble:
echo ""
echo ""
echo "* Please answer the following questions."
echo " Default answers to questions are given in square brackets."
echo " If you require help at any stage respond with a ? to the question."
echo ""
ask_staden_root:
set ANS_STADEN_ROOT = $DEF_STADEN_ROOT
ask_require_nonx_progs:
echo -n "Compile all the non-X programs in the Staden Package [$DEF_REQ_NONX]? "
set ANS_REQ_NONX = $<
if ("$ANS_REQ_NONX" == "?") then
echo "* If you do not have X windows on your system you will require"
echo " these. However, you will require Tektronics terminal emulation."
echo " If you do not require all of the non-X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_nonx_progs
else if ("$ANS_REQ_NONX" != "") then
if ("$ANS_REQ_NONX" =~ [yY]*) then
set ANS_REQ_NONX=$YES
else if ("$ANS_REQ_NONX" =~ [nN]*) then
set ANS_REQ_NONX=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_NONX=$DEF_REQ_NONX
endif
ask_require_x_progs:
echo -n "Compile all the X programs in the Staden Package [$DEF_REQ_X]? "
set ANS_REQ_X = $<
if ("$ANS_REQ_X" == "?") then
echo "* These are the programs that require X windows."
echo " If you do not require all of the X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_x_progs
else if ("$ANS_REQ_X" != "") then
if ("$ANS_REQ_X" =~ [yY]*) then
set ANS_REQ_X=$YES
else if ("$ANS_REQ_X" =~ [nN]*) then
set ANS_REQ_X=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_X=$DEF_REQ_X
endif
ask_require_ted:
echo -n "Compile the trace editing program ted [$DEF_REQ_TED]? "
set ANS_REQ_TED = $<
if ("$ANS_REQ_TED" == "?") then
echo "* This is the trace editor program. It allows you to look at"
echo " traces obtained from automated fluorescent sequencing machines."
echo ""
goto ask_require_ted
else if ("$ANS_REQ_TED" != "") then
if ("$ANS_REQ_TED" =~ [yY]*) then
set ANS_REQ_TED=$YES
else if ("$ANS_REQ_TED" =~ [nN]*) then
set ANS_REQ_TED=$NO
else
goto ask_require_ted
endif
else
set ANS_REQ_TED=$DEF_REQ_TED
endif
ask_require_misc:
echo -n "Compile other programs [$DEF_REQ_MISC]? "
set ANS_REQ_MISC = $<
if ("$ANS_REQ_MISC" == "?") then
echo "* Other programs include:"
echo " alfsplit"
echo " getABISampleName"
echo ""
goto ask_require_misc
else if ("$ANS_REQ_MISC" != "") then
if ("$ANS_REQ_MISC" =~ [yY]*) then
set ANS_REQ_MISC=$YES
else if ("$ANS_REQ_MISC" =~ [nN]*) then
set ANS_REQ_MISC=$NO
else
goto ask_require_misc
endif
else
set ANS_REQ_MISC=$DEF_REQ_MISC
endif
time_taken_warning:
echo ""
echo "The installation procedure is now ready to start."
echo ""
echo "**** Warning:"
echo " The installation will take considerable time to complete. If you"
echo " are installing the whole Staden Package from scratch it could"
echo " take as long as an hour for all exectuables to be compiled and"
echo " installed."
echo ""
ask_goahead:
echo -n "Proceed with the installation [YES]? "
set ANSWER=$<
if ("$ANSWER" == "?") then
echo "* Final confirmation to proceed with the installation. Answer"
echo " YES to proceed; otherwise, answer NO to abort the installation."
echo ""
goto ask_goahead
else if ("$ANSWER" != "") then
if ("$ANSWER" =~ [nN]*) then
goto chickens_exit
else if ("$ANSWER" !~ [yY]*) then
goto ask_goahead
endif
endif
installation_proper:
# make binaries directory if it doesn't exist
if (! -d $DIR_BIN) then
$MKDIR $DIR_BIN
endif
if ("$ANS_REQ_MISC" == "$YES" || "$ANS_REQ_X" == "$YES" || "$ANS_REQ_NONX" == "$YES" ) then
echo ""
echo "+ Compiling miscellaneous library"
pushd $DIR_MISC > /dev/null
cd $DIR_BINARIES
$MAKE all
popd > /dev/null
endif
if ("$ANS_REQ_NONX" == "$YES") then
echo ""
echo "+ Installing non X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE nprogs lprogs
$INSTALL mep $DIR_BIN
$INSTALL nip $DIR_BIN
$INSTALL pip $DIR_BIN
$INSTALL sap $DIR_BIN
$INSTALL sapf $DIR_BIN
$INSTALL sip $DIR_BIN
$INSTALL splitp1 $DIR_BIN
$INSTALL splitp2 $DIR_BIN
$INSTALL splitp3 $DIR_BIN
$INSTALL sethelp $DIR_BIN
$INSTALL gip $DIR_BIN
$INSTALL nipl $DIR_BIN
$INSTALL pipl $DIR_BIN
$INSTALL sipl $DIR_BIN
$INSTALL dap $DIR_BIN
$INSTALL nipf $DIR_BIN
$INSTALL vep $DIR_BIN
$INSTALL rep $DIR_BIN
$INSTALL lip $DIR_BIN
#$INSTALL convert_project $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE bap
$INSTALL bap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_TED" == "$YES") then
echo ""
echo "+ Installing Trace editor"
pushd $DIR_TED > /dev/null
cd $DIR_BINARIES
$MAKE ted
$INSTALL ted $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_X" == "$YES") then
echo ""
echo "+ Installing X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE xprogs
$INSTALL xmep $DIR_BIN
$INSTALL xnip $DIR_BIN
$INSTALL xpip $DIR_BIN
$INSTALL xsap $DIR_BIN
$INSTALL xsip $DIR_BIN
$INSTALL xdap $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE xbap
$INSTALL xbap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_MISC" == "$YES") then
echo ""
echo "+ Installing miscellaneous programs"
pushd $DIR_ABI > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL getABISampleName $DIR_BIN
popd > /dev/null
pushd $DIR_ALF > /dev/null
cd $DIR_BINARIES
$MAKE alfsplit
$INSTALL alfsplit $DIR_BIN
popd > /dev/null
pushd $DIR_CONVERT > /dev/null
cd $DIR_BINARIES
$MAKE convert
$INSTALL convert $DIR_BIN
popd > /dev/null
pushd $DIR_COP > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL cop $DIR_BIN
$INSTALL cop-bap $DIR_BIN
popd > /dev/null
pushd $DIR_FROG > /dev/null
cd $DIR_BINARIES
$MAKE frog
$INSTALL frog $DIR_BIN
popd > /dev/null
pushd $DIR_GETMCH > /dev/null
cd $DIR_BINARIES
$MAKE trace2seq
$INSTALL trace2seq $DIR_BIN
popd > /dev/null
pushd $DIR_SCF > /dev/null
cd $DIR_BINARIES
$MAKE makeSCF
$INSTALL makeSCF $DIR_BIN
popd > /dev/null
endif
installation_done:
echo ""
echo "+ Installation completed"
echo ""
echo " Some further initialisation is required in order to use the"
echo " package. csh users should insert the following in their .login"
echo " files:"
echo " "
echo " setenv STADENROOT $ANS_STADEN_ROOT"
echo ' source $STADENROOT/staden.login'
echo " "
echo " Users of the Bourne shell, sh, should insert the following in"
echo " their .profile:"
echo " "
echo " STADENROOT=$ANS_STADEN_ROOT"
echo " export STADENROOT"
echo ' . $STADENROOT/staden.profile'
echo " "
echo " These initialisations will alter the shell's search path so that"
echo " it can find the programs in the STADEN Package"
echo " "
normal_exit:
exit 0
chickens_exit:
echo ""
echo "+ Installation cancelled"
echo ""
exit 0
end_failure:
unset noglob
echo ""
echo "Aborted STADEN Package installation on `date`"
echo ""
exit 1

453
Staden_install-dec Normal file
View file

@ -0,0 +1,453 @@
#! /bin/csh -f
#
# staden_install - version 2.4
#
# This is a prototype installation program.
#
# 9 March 1992
# Modified for installation on Sun, Alliant, etc
# No longer install 2rs
#
# 20 November 1992
# Now includes convert, cop, frog, getMCH and scf
#
# 25 November 1992
# SGI supported
#
# 19 May 1993
# DEC Alpha, Solaris supported
#
# Written by sd@uk.ac.cam.mrc-lmb
#
# prelim
set prog = $0 ; set prog = $prog:t
# Machines supported: al sun dec sgi alpha solaris
#set MACHINE = `echo $prog | sed 's/.*-//'`
set MACHINE = dec
# For local (MRC-LMB) setup only
#set LOCAL = `echo $prog | awk '/local/{print "YES";exit;}{print "NO";}'`
set LOCAL = NO
echo ""
echo -n "Staden Package installation procedure - "
switch (${MACHINE})
case "al":
echo "Alliant FX/2800 Concentrix version"
set MAKE = "make -sk"
breaksw
case "sun":
echo "SunOS version"
set MAKE = "make -sk"
breaksw
case "dec":
echo "DEC Ultrix (mips) version"
set MAKE = "gmake -sk"
breaksw
case "sgi":
echo "Silicon Graphics Iris version"
set MAKE = "gmake -sk"
breaksw
case "alpha":
echo "DEC Alpha OSF/1 version"
set MAKE = "gmake -sk"
breaksw
case "solaris":
echo "Solaris version"
set MAKE = "make -sk"
breaksw
default:
echo "Panic. Unknown version"
exit 1
endsw
echo ""
echo "* starting initialization...please wait."
echo ""
# Binary fork of source directory
if ($LOCAL == "YES") then
set DIR_BINARIES = ${MACHINE}-binaries
set DIR_PROGS = ${MACHINE}-bin
else
set DIR_BINARIES = .
set DIR_PROGS = bin
set MAKE = "$MAKE -f makefile-${MACHINE}"
endif
init:
# Set useful shell variables
set YES="YES";
set NO="NO"
# set/unset some .cshrc envs.
unset noclobber
set noglob
# set interrupt trap
onintr end_failure
# Make dir command
set MKDIR = "mkdir"
# Copy command
set CP = "cp -p"
# Install command
#set INSTALL = "install"
#set INSTALL = "mv"
set INSTALL = "cp"
# Set up default responses
set DEF_STADEN_ROOT = `pwd`
set DEF_REQ_NONX = "$YES"
set DEF_REQ_X = "$YES"
set DEF_REQ_TED = "$YES"
set DEF_REQ_MISC = "$YES"
# directories
set DIR_SRC = $DEF_STADEN_ROOT/src
set DIR_BIN = $DEF_STADEN_ROOT/$DIR_PROGS
set DIR_MISC = $DIR_SRC/Misc
set DIR_STADEN = $DIR_SRC/staden
set DIR_TED = $DIR_SRC/ted
set DIR_ABI = $DIR_SRC/abi
set DIR_ALF = $DIR_SRC/alf
set DIR_BAP = $DIR_SRC/bap
set DIR_OSP = $DIR_SRC/bap/osp-bits
set DIR_CONVERT = $DIR_SRC/convert
set DIR_COP = $DIR_SRC/cop
set DIR_FROG = $DIR_SRC/frog
set DIR_GETMCH = $DIR_SRC/getMCH
set DIR_SCF = $DIR_SRC/scf
main:
preamble:
echo ""
echo ""
echo "* Please answer the following questions."
echo " Default answers to questions are given in square brackets."
echo " If you require help at any stage respond with a ? to the question."
echo ""
ask_staden_root:
set ANS_STADEN_ROOT = $DEF_STADEN_ROOT
ask_require_nonx_progs:
echo -n "Compile all the non-X programs in the Staden Package [$DEF_REQ_NONX]? "
set ANS_REQ_NONX = $<
if ("$ANS_REQ_NONX" == "?") then
echo "* If you do not have X windows on your system you will require"
echo " these. However, you will require Tektronics terminal emulation."
echo " If you do not require all of the non-X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_nonx_progs
else if ("$ANS_REQ_NONX" != "") then
if ("$ANS_REQ_NONX" =~ [yY]*) then
set ANS_REQ_NONX=$YES
else if ("$ANS_REQ_NONX" =~ [nN]*) then
set ANS_REQ_NONX=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_NONX=$DEF_REQ_NONX
endif
ask_require_x_progs:
echo -n "Compile all the X programs in the Staden Package [$DEF_REQ_X]? "
set ANS_REQ_X = $<
if ("$ANS_REQ_X" == "?") then
echo "* These are the programs that require X windows."
echo " If you do not require all of the X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_x_progs
else if ("$ANS_REQ_X" != "") then
if ("$ANS_REQ_X" =~ [yY]*) then
set ANS_REQ_X=$YES
else if ("$ANS_REQ_X" =~ [nN]*) then
set ANS_REQ_X=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_X=$DEF_REQ_X
endif
ask_require_ted:
echo -n "Compile the trace editing program ted [$DEF_REQ_TED]? "
set ANS_REQ_TED = $<
if ("$ANS_REQ_TED" == "?") then
echo "* This is the trace editor program. It allows you to look at"
echo " traces obtained from automated fluorescent sequencing machines."
echo ""
goto ask_require_ted
else if ("$ANS_REQ_TED" != "") then
if ("$ANS_REQ_TED" =~ [yY]*) then
set ANS_REQ_TED=$YES
else if ("$ANS_REQ_TED" =~ [nN]*) then
set ANS_REQ_TED=$NO
else
goto ask_require_ted
endif
else
set ANS_REQ_TED=$DEF_REQ_TED
endif
ask_require_misc:
echo -n "Compile other programs [$DEF_REQ_MISC]? "
set ANS_REQ_MISC = $<
if ("$ANS_REQ_MISC" == "?") then
echo "* Other programs include:"
echo " alfsplit"
echo " getABISampleName"
echo ""
goto ask_require_misc
else if ("$ANS_REQ_MISC" != "") then
if ("$ANS_REQ_MISC" =~ [yY]*) then
set ANS_REQ_MISC=$YES
else if ("$ANS_REQ_MISC" =~ [nN]*) then
set ANS_REQ_MISC=$NO
else
goto ask_require_misc
endif
else
set ANS_REQ_MISC=$DEF_REQ_MISC
endif
time_taken_warning:
echo ""
echo "The installation procedure is now ready to start."
echo ""
echo "**** Warning:"
echo " The installation will take considerable time to complete. If you"
echo " are installing the whole Staden Package from scratch it could"
echo " take as long as an hour for all exectuables to be compiled and"
echo " installed."
echo ""
ask_goahead:
echo -n "Proceed with the installation [YES]? "
set ANSWER=$<
if ("$ANSWER" == "?") then
echo "* Final confirmation to proceed with the installation. Answer"
echo " YES to proceed; otherwise, answer NO to abort the installation."
echo ""
goto ask_goahead
else if ("$ANSWER" != "") then
if ("$ANSWER" =~ [nN]*) then
goto chickens_exit
else if ("$ANSWER" !~ [yY]*) then
goto ask_goahead
endif
endif
installation_proper:
# make binaries directory if it doesn't exist
if (! -d $DIR_BIN) then
$MKDIR $DIR_BIN
endif
if ("$ANS_REQ_MISC" == "$YES" || "$ANS_REQ_X" == "$YES" || "$ANS_REQ_NONX" == "$YES" ) then
echo ""
echo "+ Compiling miscellaneous library"
pushd $DIR_MISC > /dev/null
cd $DIR_BINARIES
$MAKE all
popd > /dev/null
endif
if ("$ANS_REQ_NONX" == "$YES") then
echo ""
echo "+ Installing non X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE nprogs lprogs
$INSTALL mep $DIR_BIN
$INSTALL nip $DIR_BIN
$INSTALL pip $DIR_BIN
$INSTALL sap $DIR_BIN
$INSTALL sapf $DIR_BIN
$INSTALL sip $DIR_BIN
$INSTALL splitp1 $DIR_BIN
$INSTALL splitp2 $DIR_BIN
$INSTALL splitp3 $DIR_BIN
$INSTALL sethelp $DIR_BIN
$INSTALL gip $DIR_BIN
$INSTALL nipl $DIR_BIN
$INSTALL pipl $DIR_BIN
$INSTALL sipl $DIR_BIN
$INSTALL dap $DIR_BIN
$INSTALL nipf $DIR_BIN
$INSTALL vep $DIR_BIN
$INSTALL rep $DIR_BIN
$INSTALL lip $DIR_BIN
#$INSTALL convert_project $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE bap
$INSTALL bap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_TED" == "$YES") then
echo ""
echo "+ Installing Trace editor"
pushd $DIR_TED > /dev/null
cd $DIR_BINARIES
$MAKE ted
$INSTALL ted $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_X" == "$YES") then
echo ""
echo "+ Installing X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE xprogs
$INSTALL xmep $DIR_BIN
$INSTALL xnip $DIR_BIN
$INSTALL xpip $DIR_BIN
$INSTALL xsap $DIR_BIN
$INSTALL xsip $DIR_BIN
$INSTALL xdap $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE xbap
$INSTALL xbap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_MISC" == "$YES") then
echo ""
echo "+ Installing miscellaneous programs"
pushd $DIR_ABI > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL getABISampleName $DIR_BIN
popd > /dev/null
pushd $DIR_ALF > /dev/null
cd $DIR_BINARIES
$MAKE alfsplit
$INSTALL alfsplit $DIR_BIN
popd > /dev/null
pushd $DIR_CONVERT > /dev/null
cd $DIR_BINARIES
$MAKE convert
$INSTALL convert $DIR_BIN
popd > /dev/null
pushd $DIR_COP > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL cop $DIR_BIN
$INSTALL cop-bap $DIR_BIN
popd > /dev/null
pushd $DIR_FROG > /dev/null
cd $DIR_BINARIES
$MAKE frog
$INSTALL frog $DIR_BIN
popd > /dev/null
pushd $DIR_GETMCH > /dev/null
cd $DIR_BINARIES
$MAKE trace2seq
$INSTALL trace2seq $DIR_BIN
popd > /dev/null
pushd $DIR_SCF > /dev/null
cd $DIR_BINARIES
$MAKE makeSCF
$INSTALL makeSCF $DIR_BIN
popd > /dev/null
endif
installation_done:
echo ""
echo "+ Installation completed"
echo ""
echo " Some further initialisation is required in order to use the"
echo " package. csh users should insert the following in their .login"
echo " files:"
echo " "
echo " setenv STADENROOT $ANS_STADEN_ROOT"
echo ' source $STADENROOT/staden.login'
echo " "
echo " Users of the Bourne shell, sh, should insert the following in"
echo " their .profile:"
echo " "
echo " STADENROOT=$ANS_STADEN_ROOT"
echo " export STADENROOT"
echo ' . $STADENROOT/staden.profile'
echo " "
echo " These initialisations will alter the shell's search path so that"
echo " it can find the programs in the STADEN Package"
echo " "
normal_exit:
exit 0
chickens_exit:
echo ""
echo "+ Installation cancelled"
echo ""
exit 0
end_failure:
unset noglob
echo ""
echo "Aborted STADEN Package installation on `date`"
echo ""
exit 1

453
Staden_install-sgi Normal file
View file

@ -0,0 +1,453 @@
#! /bin/csh -f
#
# staden_install - version 2.4
#
# This is a prototype installation program.
#
# 9 March 1992
# Modified for installation on Sun, Alliant, etc
# No longer install 2rs
#
# 20 November 1992
# Now includes convert, cop, frog, getMCH and scf
#
# 25 November 1992
# SGI supported
#
# 19 May 1993
# DEC Alpha, Solaris supported
#
# Written by sd@uk.ac.cam.mrc-lmb
#
# prelim
set prog = $0 ; set prog = $prog:t
# Machines supported: al sun dec sgi alpha solaris
#set MACHINE = `echo $prog | sed 's/.*-//'`
set MACHINE = sgi
# For local (MRC-LMB) setup only
#set LOCAL = `echo $prog | awk '/local/{print "YES";exit;}{print "NO";}'`
set LOCAL = NO
echo ""
echo -n "Staden Package installation procedure - "
switch (${MACHINE})
case "al":
echo "Alliant FX/2800 Concentrix version"
set MAKE = "make -sk"
breaksw
case "sun":
echo "SunOS version"
set MAKE = "make -sk"
breaksw
case "dec":
echo "DEC Ultrix (mips) version"
set MAKE = "gmake -sk"
breaksw
case "sgi":
echo "Silicon Graphics Iris version"
set MAKE = "gmake -sk"
breaksw
case "alpha":
echo "DEC Alpha OSF/1 version"
set MAKE = "gmake -sk"
breaksw
case "solaris":
echo "Solaris version"
set MAKE = "make -sk"
breaksw
default:
echo "Panic. Unknown version"
exit 1
endsw
echo ""
echo "* starting initialization...please wait."
echo ""
# Binary fork of source directory
if ($LOCAL == "YES") then
set DIR_BINARIES = ${MACHINE}-binaries
set DIR_PROGS = ${MACHINE}-bin
else
set DIR_BINARIES = .
set DIR_PROGS = bin
set MAKE = "$MAKE -f makefile-${MACHINE}"
endif
init:
# Set useful shell variables
set YES="YES";
set NO="NO"
# set/unset some .cshrc envs.
unset noclobber
set noglob
# set interrupt trap
onintr end_failure
# Make dir command
set MKDIR = "mkdir"
# Copy command
set CP = "cp -p"
# Install command
#set INSTALL = "install"
#set INSTALL = "mv"
set INSTALL = "cp"
# Set up default responses
set DEF_STADEN_ROOT = `pwd`
set DEF_REQ_NONX = "$YES"
set DEF_REQ_X = "$YES"
set DEF_REQ_TED = "$YES"
set DEF_REQ_MISC = "$YES"
# directories
set DIR_SRC = $DEF_STADEN_ROOT/src
set DIR_BIN = $DEF_STADEN_ROOT/$DIR_PROGS
set DIR_MISC = $DIR_SRC/Misc
set DIR_STADEN = $DIR_SRC/staden
set DIR_TED = $DIR_SRC/ted
set DIR_ABI = $DIR_SRC/abi
set DIR_ALF = $DIR_SRC/alf
set DIR_BAP = $DIR_SRC/bap
set DIR_OSP = $DIR_SRC/bap/osp-bits
set DIR_CONVERT = $DIR_SRC/convert
set DIR_COP = $DIR_SRC/cop
set DIR_FROG = $DIR_SRC/frog
set DIR_GETMCH = $DIR_SRC/getMCH
set DIR_SCF = $DIR_SRC/scf
main:
preamble:
echo ""
echo ""
echo "* Please answer the following questions."
echo " Default answers to questions are given in square brackets."
echo " If you require help at any stage respond with a ? to the question."
echo ""
ask_staden_root:
set ANS_STADEN_ROOT = $DEF_STADEN_ROOT
ask_require_nonx_progs:
echo -n "Compile all the non-X programs in the Staden Package [$DEF_REQ_NONX]? "
set ANS_REQ_NONX = $<
if ("$ANS_REQ_NONX" == "?") then
echo "* If you do not have X windows on your system you will require"
echo " these. However, you will require Tektronics terminal emulation."
echo " If you do not require all of the non-X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_nonx_progs
else if ("$ANS_REQ_NONX" != "") then
if ("$ANS_REQ_NONX" =~ [yY]*) then
set ANS_REQ_NONX=$YES
else if ("$ANS_REQ_NONX" =~ [nN]*) then
set ANS_REQ_NONX=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_NONX=$DEF_REQ_NONX
endif
ask_require_x_progs:
echo -n "Compile all the X programs in the Staden Package [$DEF_REQ_X]? "
set ANS_REQ_X = $<
if ("$ANS_REQ_X" == "?") then
echo "* These are the programs that require X windows."
echo " If you do not require all of the X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_x_progs
else if ("$ANS_REQ_X" != "") then
if ("$ANS_REQ_X" =~ [yY]*) then
set ANS_REQ_X=$YES
else if ("$ANS_REQ_X" =~ [nN]*) then
set ANS_REQ_X=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_X=$DEF_REQ_X
endif
ask_require_ted:
echo -n "Compile the trace editing program ted [$DEF_REQ_TED]? "
set ANS_REQ_TED = $<
if ("$ANS_REQ_TED" == "?") then
echo "* This is the trace editor program. It allows you to look at"
echo " traces obtained from automated fluorescent sequencing machines."
echo ""
goto ask_require_ted
else if ("$ANS_REQ_TED" != "") then
if ("$ANS_REQ_TED" =~ [yY]*) then
set ANS_REQ_TED=$YES
else if ("$ANS_REQ_TED" =~ [nN]*) then
set ANS_REQ_TED=$NO
else
goto ask_require_ted
endif
else
set ANS_REQ_TED=$DEF_REQ_TED
endif
ask_require_misc:
echo -n "Compile other programs [$DEF_REQ_MISC]? "
set ANS_REQ_MISC = $<
if ("$ANS_REQ_MISC" == "?") then
echo "* Other programs include:"
echo " alfsplit"
echo " getABISampleName"
echo ""
goto ask_require_misc
else if ("$ANS_REQ_MISC" != "") then
if ("$ANS_REQ_MISC" =~ [yY]*) then
set ANS_REQ_MISC=$YES
else if ("$ANS_REQ_MISC" =~ [nN]*) then
set ANS_REQ_MISC=$NO
else
goto ask_require_misc
endif
else
set ANS_REQ_MISC=$DEF_REQ_MISC
endif
time_taken_warning:
echo ""
echo "The installation procedure is now ready to start."
echo ""
echo "**** Warning:"
echo " The installation will take considerable time to complete. If you"
echo " are installing the whole Staden Package from scratch it could"
echo " take as long as an hour for all exectuables to be compiled and"
echo " installed."
echo ""
ask_goahead:
echo -n "Proceed with the installation [YES]? "
set ANSWER=$<
if ("$ANSWER" == "?") then
echo "* Final confirmation to proceed with the installation. Answer"
echo " YES to proceed; otherwise, answer NO to abort the installation."
echo ""
goto ask_goahead
else if ("$ANSWER" != "") then
if ("$ANSWER" =~ [nN]*) then
goto chickens_exit
else if ("$ANSWER" !~ [yY]*) then
goto ask_goahead
endif
endif
installation_proper:
# make binaries directory if it doesn't exist
if (! -d $DIR_BIN) then
$MKDIR $DIR_BIN
endif
if ("$ANS_REQ_MISC" == "$YES" || "$ANS_REQ_X" == "$YES" || "$ANS_REQ_NONX" == "$YES" ) then
echo ""
echo "+ Compiling miscellaneous library"
pushd $DIR_MISC > /dev/null
cd $DIR_BINARIES
$MAKE all
popd > /dev/null
endif
if ("$ANS_REQ_NONX" == "$YES") then
echo ""
echo "+ Installing non X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE nprogs lprogs
$INSTALL mep $DIR_BIN
$INSTALL nip $DIR_BIN
$INSTALL pip $DIR_BIN
$INSTALL sap $DIR_BIN
$INSTALL sapf $DIR_BIN
$INSTALL sip $DIR_BIN
$INSTALL splitp1 $DIR_BIN
$INSTALL splitp2 $DIR_BIN
$INSTALL splitp3 $DIR_BIN
$INSTALL sethelp $DIR_BIN
$INSTALL gip $DIR_BIN
$INSTALL nipl $DIR_BIN
$INSTALL pipl $DIR_BIN
$INSTALL sipl $DIR_BIN
$INSTALL dap $DIR_BIN
$INSTALL nipf $DIR_BIN
$INSTALL vep $DIR_BIN
$INSTALL rep $DIR_BIN
$INSTALL lip $DIR_BIN
#$INSTALL convert_project $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE bap
$INSTALL bap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_TED" == "$YES") then
echo ""
echo "+ Installing Trace editor"
pushd $DIR_TED > /dev/null
cd $DIR_BINARIES
$MAKE ted
$INSTALL ted $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_X" == "$YES") then
echo ""
echo "+ Installing X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE xprogs
$INSTALL xmep $DIR_BIN
$INSTALL xnip $DIR_BIN
$INSTALL xpip $DIR_BIN
$INSTALL xsap $DIR_BIN
$INSTALL xsip $DIR_BIN
$INSTALL xdap $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE xbap
$INSTALL xbap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_MISC" == "$YES") then
echo ""
echo "+ Installing miscellaneous programs"
pushd $DIR_ABI > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL getABISampleName $DIR_BIN
popd > /dev/null
pushd $DIR_ALF > /dev/null
cd $DIR_BINARIES
$MAKE alfsplit
$INSTALL alfsplit $DIR_BIN
popd > /dev/null
pushd $DIR_CONVERT > /dev/null
cd $DIR_BINARIES
$MAKE convert
$INSTALL convert $DIR_BIN
popd > /dev/null
pushd $DIR_COP > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL cop $DIR_BIN
$INSTALL cop-bap $DIR_BIN
popd > /dev/null
pushd $DIR_FROG > /dev/null
cd $DIR_BINARIES
$MAKE frog
$INSTALL frog $DIR_BIN
popd > /dev/null
pushd $DIR_GETMCH > /dev/null
cd $DIR_BINARIES
$MAKE trace2seq
$INSTALL trace2seq $DIR_BIN
popd > /dev/null
pushd $DIR_SCF > /dev/null
cd $DIR_BINARIES
$MAKE makeSCF
$INSTALL makeSCF $DIR_BIN
popd > /dev/null
endif
installation_done:
echo ""
echo "+ Installation completed"
echo ""
echo " Some further initialisation is required in order to use the"
echo " package. csh users should insert the following in their .login"
echo " files:"
echo " "
echo " setenv STADENROOT $ANS_STADEN_ROOT"
echo ' source $STADENROOT/staden.login'
echo " "
echo " Users of the Bourne shell, sh, should insert the following in"
echo " their .profile:"
echo " "
echo " STADENROOT=$ANS_STADEN_ROOT"
echo " export STADENROOT"
echo ' . $STADENROOT/staden.profile'
echo " "
echo " These initialisations will alter the shell's search path so that"
echo " it can find the programs in the STADEN Package"
echo " "
normal_exit:
exit 0
chickens_exit:
echo ""
echo "+ Installation cancelled"
echo ""
exit 0
end_failure:
unset noglob
echo ""
echo "Aborted STADEN Package installation on `date`"
echo ""
exit 1

453
Staden_install-solaris Normal file
View file

@ -0,0 +1,453 @@
#! /bin/csh -f
#
# staden_install - version 2.4
#
# This is a prototype installation program.
#
# 9 March 1992
# Modified for installation on Sun, Alliant, etc
# No longer install 2rs
#
# 20 November 1992
# Now includes convert, cop, frog, getMCH and scf
#
# 25 November 1992
# SGI supported
#
# 19 May 1993
# DEC Alpha, Solaris supported
#
# Written by sd@uk.ac.cam.mrc-lmb
#
# prelim
set prog = $0 ; set prog = $prog:t
# Machines supported: al sun dec sgi alpha solaris
#set MACHINE = `echo $prog | sed 's/.*-//'`
set MACHINE = solaris
# For local (MRC-LMB) setup only
#set LOCAL = `echo $prog | awk '/local/{print "YES";exit;}{print "NO";}'`
set LOCAL = NO
echo ""
echo -n "Staden Package installation procedure - "
switch (${MACHINE})
case "al":
echo "Alliant FX/2800 Concentrix version"
set MAKE = "make -sk"
breaksw
case "sun":
echo "SunOS version"
set MAKE = "make -sk"
breaksw
case "dec":
echo "DEC Ultrix (mips) version"
set MAKE = "gmake -sk"
breaksw
case "sgi":
echo "Silicon Graphics Iris version"
set MAKE = "gmake -sk"
breaksw
case "alpha":
echo "DEC Alpha OSF/1 version"
set MAKE = "gmake -sk"
breaksw
case "solaris":
echo "Solaris version"
set MAKE = "make -sk"
breaksw
default:
echo "Panic. Unknown version"
exit 1
endsw
echo ""
echo "* starting initialization...please wait."
echo ""
# Binary fork of source directory
if ($LOCAL == "YES") then
set DIR_BINARIES = ${MACHINE}-binaries
set DIR_PROGS = ${MACHINE}-bin
else
set DIR_BINARIES = .
set DIR_PROGS = bin
set MAKE = "$MAKE -f makefile-${MACHINE}"
endif
init:
# Set useful shell variables
set YES="YES";
set NO="NO"
# set/unset some .cshrc envs.
unset noclobber
set noglob
# set interrupt trap
onintr end_failure
# Make dir command
set MKDIR = "mkdir"
# Copy command
set CP = "cp -p"
# Install command
#set INSTALL = "install"
#set INSTALL = "mv"
set INSTALL = "cp"
# Set up default responses
set DEF_STADEN_ROOT = `pwd`
set DEF_REQ_NONX = "$YES"
set DEF_REQ_X = "$YES"
set DEF_REQ_TED = "$YES"
set DEF_REQ_MISC = "$YES"
# directories
set DIR_SRC = $DEF_STADEN_ROOT/src
set DIR_BIN = $DEF_STADEN_ROOT/$DIR_PROGS
set DIR_MISC = $DIR_SRC/Misc
set DIR_STADEN = $DIR_SRC/staden
set DIR_TED = $DIR_SRC/ted
set DIR_ABI = $DIR_SRC/abi
set DIR_ALF = $DIR_SRC/alf
set DIR_BAP = $DIR_SRC/bap
set DIR_OSP = $DIR_SRC/bap/osp-bits
set DIR_CONVERT = $DIR_SRC/convert
set DIR_COP = $DIR_SRC/cop
set DIR_FROG = $DIR_SRC/frog
set DIR_GETMCH = $DIR_SRC/getMCH
set DIR_SCF = $DIR_SRC/scf
main:
preamble:
echo ""
echo ""
echo "* Please answer the following questions."
echo " Default answers to questions are given in square brackets."
echo " If you require help at any stage respond with a ? to the question."
echo ""
ask_staden_root:
set ANS_STADEN_ROOT = $DEF_STADEN_ROOT
ask_require_nonx_progs:
echo -n "Compile all the non-X programs in the Staden Package [$DEF_REQ_NONX]? "
set ANS_REQ_NONX = $<
if ("$ANS_REQ_NONX" == "?") then
echo "* If you do not have X windows on your system you will require"
echo " these. However, you will require Tektronics terminal emulation."
echo " If you do not require all of the non-X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_nonx_progs
else if ("$ANS_REQ_NONX" != "") then
if ("$ANS_REQ_NONX" =~ [yY]*) then
set ANS_REQ_NONX=$YES
else if ("$ANS_REQ_NONX" =~ [nN]*) then
set ANS_REQ_NONX=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_NONX=$DEF_REQ_NONX
endif
ask_require_x_progs:
echo -n "Compile all the X programs in the Staden Package [$DEF_REQ_X]? "
set ANS_REQ_X = $<
if ("$ANS_REQ_X" == "?") then
echo "* These are the programs that require X windows."
echo " If you do not require all of the X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_x_progs
else if ("$ANS_REQ_X" != "") then
if ("$ANS_REQ_X" =~ [yY]*) then
set ANS_REQ_X=$YES
else if ("$ANS_REQ_X" =~ [nN]*) then
set ANS_REQ_X=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_X=$DEF_REQ_X
endif
ask_require_ted:
echo -n "Compile the trace editing program ted [$DEF_REQ_TED]? "
set ANS_REQ_TED = $<
if ("$ANS_REQ_TED" == "?") then
echo "* This is the trace editor program. It allows you to look at"
echo " traces obtained from automated fluorescent sequencing machines."
echo ""
goto ask_require_ted
else if ("$ANS_REQ_TED" != "") then
if ("$ANS_REQ_TED" =~ [yY]*) then
set ANS_REQ_TED=$YES
else if ("$ANS_REQ_TED" =~ [nN]*) then
set ANS_REQ_TED=$NO
else
goto ask_require_ted
endif
else
set ANS_REQ_TED=$DEF_REQ_TED
endif
ask_require_misc:
echo -n "Compile other programs [$DEF_REQ_MISC]? "
set ANS_REQ_MISC = $<
if ("$ANS_REQ_MISC" == "?") then
echo "* Other programs include:"
echo " alfsplit"
echo " getABISampleName"
echo ""
goto ask_require_misc
else if ("$ANS_REQ_MISC" != "") then
if ("$ANS_REQ_MISC" =~ [yY]*) then
set ANS_REQ_MISC=$YES
else if ("$ANS_REQ_MISC" =~ [nN]*) then
set ANS_REQ_MISC=$NO
else
goto ask_require_misc
endif
else
set ANS_REQ_MISC=$DEF_REQ_MISC
endif
time_taken_warning:
echo ""
echo "The installation procedure is now ready to start."
echo ""
echo "**** Warning:"
echo " The installation will take considerable time to complete. If you"
echo " are installing the whole Staden Package from scratch it could"
echo " take as long as an hour for all exectuables to be compiled and"
echo " installed."
echo ""
ask_goahead:
echo -n "Proceed with the installation [YES]? "
set ANSWER=$<
if ("$ANSWER" == "?") then
echo "* Final confirmation to proceed with the installation. Answer"
echo " YES to proceed; otherwise, answer NO to abort the installation."
echo ""
goto ask_goahead
else if ("$ANSWER" != "") then
if ("$ANSWER" =~ [nN]*) then
goto chickens_exit
else if ("$ANSWER" !~ [yY]*) then
goto ask_goahead
endif
endif
installation_proper:
# make binaries directory if it doesn't exist
if (! -d $DIR_BIN) then
$MKDIR $DIR_BIN
endif
if ("$ANS_REQ_MISC" == "$YES" || "$ANS_REQ_X" == "$YES" || "$ANS_REQ_NONX" == "$YES" ) then
echo ""
echo "+ Compiling miscellaneous library"
pushd $DIR_MISC > /dev/null
cd $DIR_BINARIES
$MAKE all
popd > /dev/null
endif
if ("$ANS_REQ_NONX" == "$YES") then
echo ""
echo "+ Installing non X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE nprogs lprogs
$INSTALL mep $DIR_BIN
$INSTALL nip $DIR_BIN
$INSTALL pip $DIR_BIN
$INSTALL sap $DIR_BIN
$INSTALL sapf $DIR_BIN
$INSTALL sip $DIR_BIN
$INSTALL splitp1 $DIR_BIN
$INSTALL splitp2 $DIR_BIN
$INSTALL splitp3 $DIR_BIN
$INSTALL sethelp $DIR_BIN
$INSTALL gip $DIR_BIN
$INSTALL nipl $DIR_BIN
$INSTALL pipl $DIR_BIN
$INSTALL sipl $DIR_BIN
$INSTALL dap $DIR_BIN
$INSTALL nipf $DIR_BIN
$INSTALL vep $DIR_BIN
$INSTALL rep $DIR_BIN
$INSTALL lip $DIR_BIN
#$INSTALL convert_project $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE bap
$INSTALL bap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_TED" == "$YES") then
echo ""
echo "+ Installing Trace editor"
pushd $DIR_TED > /dev/null
cd $DIR_BINARIES
$MAKE ted
$INSTALL ted $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_X" == "$YES") then
echo ""
echo "+ Installing X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE xprogs
$INSTALL xmep $DIR_BIN
$INSTALL xnip $DIR_BIN
$INSTALL xpip $DIR_BIN
$INSTALL xsap $DIR_BIN
$INSTALL xsip $DIR_BIN
$INSTALL xdap $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE xbap
$INSTALL xbap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_MISC" == "$YES") then
echo ""
echo "+ Installing miscellaneous programs"
pushd $DIR_ABI > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL getABISampleName $DIR_BIN
popd > /dev/null
pushd $DIR_ALF > /dev/null
cd $DIR_BINARIES
$MAKE alfsplit
$INSTALL alfsplit $DIR_BIN
popd > /dev/null
pushd $DIR_CONVERT > /dev/null
cd $DIR_BINARIES
$MAKE convert
$INSTALL convert $DIR_BIN
popd > /dev/null
pushd $DIR_COP > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL cop $DIR_BIN
$INSTALL cop-bap $DIR_BIN
popd > /dev/null
pushd $DIR_FROG > /dev/null
cd $DIR_BINARIES
$MAKE frog
$INSTALL frog $DIR_BIN
popd > /dev/null
pushd $DIR_GETMCH > /dev/null
cd $DIR_BINARIES
$MAKE trace2seq
$INSTALL trace2seq $DIR_BIN
popd > /dev/null
pushd $DIR_SCF > /dev/null
cd $DIR_BINARIES
$MAKE makeSCF
$INSTALL makeSCF $DIR_BIN
popd > /dev/null
endif
installation_done:
echo ""
echo "+ Installation completed"
echo ""
echo " Some further initialisation is required in order to use the"
echo " package. csh users should insert the following in their .login"
echo " files:"
echo " "
echo " setenv STADENROOT $ANS_STADEN_ROOT"
echo ' source $STADENROOT/staden.login'
echo " "
echo " Users of the Bourne shell, sh, should insert the following in"
echo " their .profile:"
echo " "
echo " STADENROOT=$ANS_STADEN_ROOT"
echo " export STADENROOT"
echo ' . $STADENROOT/staden.profile'
echo " "
echo " These initialisations will alter the shell's search path so that"
echo " it can find the programs in the STADEN Package"
echo " "
normal_exit:
exit 0
chickens_exit:
echo ""
echo "+ Installation cancelled"
echo ""
exit 0
end_failure:
unset noglob
echo ""
echo "Aborted STADEN Package installation on `date`"
echo ""
exit 1

453
Staden_install-sun Normal file
View file

@ -0,0 +1,453 @@
#! /bin/csh -f
#
# staden_install - version 2.4
#
# This is a prototype installation program.
#
# 9 March 1992
# Modified for installation on Sun, Alliant, etc
# No longer install 2rs
#
# 20 November 1992
# Now includes convert, cop, frog, getMCH and scf
#
# 25 November 1992
# SGI supported
#
# 19 May 1993
# DEC Alpha, Solaris supported
#
# Written by sd@uk.ac.cam.mrc-lmb
#
# prelim
set prog = $0 ; set prog = $prog:t
# Machines supported: al sun dec sgi alpha solaris
#set MACHINE = `echo $prog | sed 's/.*-//'`
set MACHINE = sun
# For local (MRC-LMB) setup only
#set LOCAL = `echo $prog | awk '/local/{print "YES";exit;}{print "NO";}'`
set LOCAL = NO
echo ""
echo -n "Staden Package installation procedure - "
switch (${MACHINE})
case "al":
echo "Alliant FX/2800 Concentrix version"
set MAKE = "make -sk"
breaksw
case "sun":
echo "SunOS version"
set MAKE = "make -sk"
breaksw
case "dec":
echo "DEC Ultrix (mips) version"
set MAKE = "gmake -sk"
breaksw
case "sgi":
echo "Silicon Graphics Iris version"
set MAKE = "gmake -sk"
breaksw
case "alpha":
echo "DEC Alpha OSF/1 version"
set MAKE = "gmake -sk"
breaksw
case "solaris":
echo "Solaris version"
set MAKE = "make -sk"
breaksw
default:
echo "Panic. Unknown version"
exit 1
endsw
echo ""
echo "* starting initialization...please wait."
echo ""
# Binary fork of source directory
if ($LOCAL == "YES") then
set DIR_BINARIES = ${MACHINE}-binaries
set DIR_PROGS = ${MACHINE}-bin
else
set DIR_BINARIES = .
set DIR_PROGS = bin
set MAKE = "$MAKE -f makefile-${MACHINE}"
endif
init:
# Set useful shell variables
set YES="YES";
set NO="NO"
# set/unset some .cshrc envs.
unset noclobber
set noglob
# set interrupt trap
onintr end_failure
# Make dir command
set MKDIR = "mkdir"
# Copy command
set CP = "cp -p"
# Install command
#set INSTALL = "install"
#set INSTALL = "mv"
set INSTALL = "cp"
# Set up default responses
set DEF_STADEN_ROOT = `pwd`
set DEF_REQ_NONX = "$YES"
set DEF_REQ_X = "$YES"
set DEF_REQ_TED = "$YES"
set DEF_REQ_MISC = "$YES"
# directories
set DIR_SRC = $DEF_STADEN_ROOT/src
set DIR_BIN = $DEF_STADEN_ROOT/$DIR_PROGS
set DIR_MISC = $DIR_SRC/Misc
set DIR_STADEN = $DIR_SRC/staden
set DIR_TED = $DIR_SRC/ted
set DIR_ABI = $DIR_SRC/abi
set DIR_ALF = $DIR_SRC/alf
set DIR_BAP = $DIR_SRC/bap
set DIR_OSP = $DIR_SRC/bap/osp-bits
set DIR_CONVERT = $DIR_SRC/convert
set DIR_COP = $DIR_SRC/cop
set DIR_FROG = $DIR_SRC/frog
set DIR_GETMCH = $DIR_SRC/getMCH
set DIR_SCF = $DIR_SRC/scf
main:
preamble:
echo ""
echo ""
echo "* Please answer the following questions."
echo " Default answers to questions are given in square brackets."
echo " If you require help at any stage respond with a ? to the question."
echo ""
ask_staden_root:
set ANS_STADEN_ROOT = $DEF_STADEN_ROOT
ask_require_nonx_progs:
echo -n "Compile all the non-X programs in the Staden Package [$DEF_REQ_NONX]? "
set ANS_REQ_NONX = $<
if ("$ANS_REQ_NONX" == "?") then
echo "* If you do not have X windows on your system you will require"
echo " these. However, you will require Tektronics terminal emulation."
echo " If you do not require all of the non-X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_nonx_progs
else if ("$ANS_REQ_NONX" != "") then
if ("$ANS_REQ_NONX" =~ [yY]*) then
set ANS_REQ_NONX=$YES
else if ("$ANS_REQ_NONX" =~ [nN]*) then
set ANS_REQ_NONX=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_NONX=$DEF_REQ_NONX
endif
ask_require_x_progs:
echo -n "Compile all the X programs in the Staden Package [$DEF_REQ_X]? "
set ANS_REQ_X = $<
if ("$ANS_REQ_X" == "?") then
echo "* These are the programs that require X windows."
echo " If you do not require all of the X programs, you should abort"
echo " and manually make the ones you require."
echo ""
goto ask_require_x_progs
else if ("$ANS_REQ_X" != "") then
if ("$ANS_REQ_X" =~ [yY]*) then
set ANS_REQ_X=$YES
else if ("$ANS_REQ_X" =~ [nN]*) then
set ANS_REQ_X=$NO
else
goto ask_require_nonx_progs
endif
else
set ANS_REQ_X=$DEF_REQ_X
endif
ask_require_ted:
echo -n "Compile the trace editing program ted [$DEF_REQ_TED]? "
set ANS_REQ_TED = $<
if ("$ANS_REQ_TED" == "?") then
echo "* This is the trace editor program. It allows you to look at"
echo " traces obtained from automated fluorescent sequencing machines."
echo ""
goto ask_require_ted
else if ("$ANS_REQ_TED" != "") then
if ("$ANS_REQ_TED" =~ [yY]*) then
set ANS_REQ_TED=$YES
else if ("$ANS_REQ_TED" =~ [nN]*) then
set ANS_REQ_TED=$NO
else
goto ask_require_ted
endif
else
set ANS_REQ_TED=$DEF_REQ_TED
endif
ask_require_misc:
echo -n "Compile other programs [$DEF_REQ_MISC]? "
set ANS_REQ_MISC = $<
if ("$ANS_REQ_MISC" == "?") then
echo "* Other programs include:"
echo " alfsplit"
echo " getABISampleName"
echo ""
goto ask_require_misc
else if ("$ANS_REQ_MISC" != "") then
if ("$ANS_REQ_MISC" =~ [yY]*) then
set ANS_REQ_MISC=$YES
else if ("$ANS_REQ_MISC" =~ [nN]*) then
set ANS_REQ_MISC=$NO
else
goto ask_require_misc
endif
else
set ANS_REQ_MISC=$DEF_REQ_MISC
endif
time_taken_warning:
echo ""
echo "The installation procedure is now ready to start."
echo ""
echo "**** Warning:"
echo " The installation will take considerable time to complete. If you"
echo " are installing the whole Staden Package from scratch it could"
echo " take as long as an hour for all exectuables to be compiled and"
echo " installed."
echo ""
ask_goahead:
echo -n "Proceed with the installation [YES]? "
set ANSWER=$<
if ("$ANSWER" == "?") then
echo "* Final confirmation to proceed with the installation. Answer"
echo " YES to proceed; otherwise, answer NO to abort the installation."
echo ""
goto ask_goahead
else if ("$ANSWER" != "") then
if ("$ANSWER" =~ [nN]*) then
goto chickens_exit
else if ("$ANSWER" !~ [yY]*) then
goto ask_goahead
endif
endif
installation_proper:
# make binaries directory if it doesn't exist
if (! -d $DIR_BIN) then
$MKDIR $DIR_BIN
endif
if ("$ANS_REQ_MISC" == "$YES" || "$ANS_REQ_X" == "$YES" || "$ANS_REQ_NONX" == "$YES" ) then
echo ""
echo "+ Compiling miscellaneous library"
pushd $DIR_MISC > /dev/null
cd $DIR_BINARIES
$MAKE all
popd > /dev/null
endif
if ("$ANS_REQ_NONX" == "$YES") then
echo ""
echo "+ Installing non X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE nprogs lprogs
$INSTALL mep $DIR_BIN
$INSTALL nip $DIR_BIN
$INSTALL pip $DIR_BIN
$INSTALL sap $DIR_BIN
$INSTALL sapf $DIR_BIN
$INSTALL sip $DIR_BIN
$INSTALL splitp1 $DIR_BIN
$INSTALL splitp2 $DIR_BIN
$INSTALL splitp3 $DIR_BIN
$INSTALL sethelp $DIR_BIN
$INSTALL gip $DIR_BIN
$INSTALL nipl $DIR_BIN
$INSTALL pipl $DIR_BIN
$INSTALL sipl $DIR_BIN
$INSTALL dap $DIR_BIN
$INSTALL nipf $DIR_BIN
$INSTALL vep $DIR_BIN
$INSTALL rep $DIR_BIN
$INSTALL lip $DIR_BIN
#$INSTALL convert_project $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE bap
$INSTALL bap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_TED" == "$YES") then
echo ""
echo "+ Installing Trace editor"
pushd $DIR_TED > /dev/null
cd $DIR_BINARIES
$MAKE ted
$INSTALL ted $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_X" == "$YES") then
echo ""
echo "+ Installing X programs"
pushd $DIR_STADEN > /dev/null
cd $DIR_BINARIES
$MAKE xprogs
$INSTALL xmep $DIR_BIN
$INSTALL xnip $DIR_BIN
$INSTALL xpip $DIR_BIN
$INSTALL xsap $DIR_BIN
$INSTALL xsip $DIR_BIN
$INSTALL xdap $DIR_BIN
popd > /dev/null
pushd $DIR_OSP > /dev/null
cd $DIR_BINARIES
$MAKE
popd > /dev/null
pushd $DIR_BAP > /dev/null
cd $DIR_BINARIES
$MAKE xbap
$INSTALL xbap $DIR_BIN
popd > /dev/null
endif
if ("$ANS_REQ_MISC" == "$YES") then
echo ""
echo "+ Installing miscellaneous programs"
pushd $DIR_ABI > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL getABISampleName $DIR_BIN
popd > /dev/null
pushd $DIR_ALF > /dev/null
cd $DIR_BINARIES
$MAKE alfsplit
$INSTALL alfsplit $DIR_BIN
popd > /dev/null
pushd $DIR_CONVERT > /dev/null
cd $DIR_BINARIES
$MAKE convert
$INSTALL convert $DIR_BIN
popd > /dev/null
pushd $DIR_COP > /dev/null
cd $DIR_BINARIES
$MAKE all
$INSTALL cop $DIR_BIN
$INSTALL cop-bap $DIR_BIN
popd > /dev/null
pushd $DIR_FROG > /dev/null
cd $DIR_BINARIES
$MAKE frog
$INSTALL frog $DIR_BIN
popd > /dev/null
pushd $DIR_GETMCH > /dev/null
cd $DIR_BINARIES
$MAKE trace2seq
$INSTALL trace2seq $DIR_BIN
popd > /dev/null
pushd $DIR_SCF > /dev/null
cd $DIR_BINARIES
$MAKE makeSCF
$INSTALL makeSCF $DIR_BIN
popd > /dev/null
endif
installation_done:
echo ""
echo "+ Installation completed"
echo ""
echo " Some further initialisation is required in order to use the"
echo " package. csh users should insert the following in their .login"
echo " files:"
echo " "
echo " setenv STADENROOT $ANS_STADEN_ROOT"
echo ' source $STADENROOT/staden.login'
echo " "
echo " Users of the Bourne shell, sh, should insert the following in"
echo " their .profile:"
echo " "
echo " STADENROOT=$ANS_STADEN_ROOT"
echo " export STADENROOT"
echo ' . $STADENROOT/staden.profile'
echo " "
echo " These initialisations will alter the shell's search path so that"
echo " it can find the programs in the STADEN Package"
echo " "
normal_exit:
exit 0
chickens_exit:
echo ""
echo "+ Installation cancelled"
echo ""
exit 0
end_failure:
unset noglob
echo ""
echo "Aborted STADEN Package installation on `date`"
echo ""
exit 1

91
Version-1993.0.7 Normal file
View file

@ -0,0 +1,91 @@
Wed Jul 7
*Version-1993.0.7*
New xbap and ted.
Can use Ctrl as well as Meta to shift cutoffs in contig editor.
Code to read in ABI traces now robust to ABI problem files, where
called base order is not base position order.
Thu Jul 1
*Version-1993.0.6*
New xbap and bap, to fix bugs.
Break Contig was sometimes not recalculating consensus length correctly.
Contig Edit was trucating reading name lengths at 10 characters.
Thu Jun 16
*Version-1993.0.5*
New xbap and bap executables. RS changed assembly in bap so that
when entry is not permitted the program asks for the percentage
mismatch - this allows display of alignments for all levels of
mismatch.
Mon Jun 14 14:54:43 BST 1993
*Version-1993.0.4*
Bug in xdap. It was compiled with xbap's edUtils.h by mistake.
Fri Jun 11 17:50:13 BST 1993
*Version-1993.0.3*
Bugs in bap/xbap fixed. New executables included.
Thu Jun 3 13:53:38 BST 1993
*Version-1993.0.2*
Bugs in bap/xbap fixed. New executables included.
Thu May 20 14:45:38 BST 1993
*Version-1993.0.1*
Changes to makefiles and Staden_install
Fri Mar 5 11:27:22 GMT 1993
*Version-1993.0*
Now for DEC Alpha and Solaris
bap/xbap now includes double stranding and auto-creation of oligos
Tue Jan 26 11:54:36 GMT 1993
*Version-1992.3.1*
Bug fixes
1. indexseqlibs/genbentryname1.c
2. convert bugs + new programs
Mon Nov 23 13:50:39 WET 1992
*Version-1992.3*
Includes bap/xbap and utility programs
Wed Sep 30 11:18:09 BST 1992
*Version-1992.2.1*
Source changes since last release
bug fixes to postscript output, sequence library programs
New sun and dec executables
Thu Aug 27 15:27:05 BST 1992
*Version-1992.2*
Mon Jul 27 13:01:37 WET 1992
*Version-1992.1.3*
Miscellaneous bug fixes and enhancements
New sun and dec executables
Tue Jun 16 16:07:41 BST 1992
*Version-1992.1.2*
Sun sparc executables now linked with cc and not gcc.
New makefile-sun files
New sources for hitNtrg.c and freetext4.c (indexseqlibs), and
tagU2.c (staden)
Wed May 27 17:12:36 BST 1992
*Version-1992.1.1*
Inclusion of vep (vector excision program), plus minor changes and bug fixes
Tue May 26 11:10:28 WET 1992
*Version-1992.1*
This version includes the port to DEC Ultrix (mips)

BIN
bin/alfsplit Normal file
View file

Binary file not shown.

BIN
bin/bap Normal file
View file

Binary file not shown.

BIN
bin/convert Normal file
View file

Binary file not shown.

BIN
bin/cop Normal file
View file

Binary file not shown.

BIN
bin/cop-bap Normal file
View file

Binary file not shown.

BIN
bin/dap Normal file
View file

Binary file not shown.

BIN
bin/frog Normal file
View file

Binary file not shown.

BIN
bin/getABISampleName Normal file
View file

Binary file not shown.

BIN
bin/gip Normal file
View file

Binary file not shown.

BIN
bin/lip Normal file
View file

Binary file not shown.

BIN
bin/makeSCF Normal file
View file

Binary file not shown.

BIN
bin/mep Normal file
View file

Binary file not shown.

BIN
bin/nip Normal file
View file

Binary file not shown.

BIN
bin/nipf Normal file
View file

Binary file not shown.

BIN
bin/nipl Normal file
View file

Binary file not shown.

BIN
bin/pip Normal file
View file

Binary file not shown.

BIN
bin/pipl Normal file
View file

Binary file not shown.

BIN
bin/rep Normal file
View file

Binary file not shown.

BIN
bin/sap Normal file
View file

Binary file not shown.

BIN
bin/sapf Normal file
View file

Binary file not shown.

BIN
bin/sethelp Normal file
View file

Binary file not shown.

BIN
bin/sip Normal file
View file

Binary file not shown.

BIN
bin/sipl Normal file
View file

Binary file not shown.

BIN
bin/splitp1 Normal file
View file

Binary file not shown.

BIN
bin/splitp2 Normal file
View file

Binary file not shown.

BIN
bin/splitp3 Normal file
View file

Binary file not shown.

BIN
bin/ted Normal file
View file

Binary file not shown.

BIN
bin/trace2seq Normal file
View file

Binary file not shown.

BIN
bin/vep Normal file
View file

Binary file not shown.

BIN
bin/xbap Normal file
View file

Binary file not shown.

BIN
bin/xbap.1 Normal file
View file

Binary file not shown.

BIN
bin/xdap Normal file
View file

Binary file not shown.

BIN
bin/xmep Normal file
View file

Binary file not shown.

BIN
bin/xnip Normal file
View file

Binary file not shown.

BIN
bin/xpip Normal file
View file

Binary file not shown.

BIN
bin/xsap Normal file
View file

Binary file not shown.

BIN
bin/xsip Normal file
View file

Binary file not shown.

32
doc/Converting_Sap_Databases Normal file
View file

@ -0,0 +1,32 @@
Converting Sap Databases For Be Used With XDAP SD 10 July 1991
=======================================================================
The sequence assembly programmes dap and xdap are based on the programs
sap and xsap, with major modifications. For a concise summary of the
new features I refer you to Rodger and my paper, "A sequence assembly
and editing program for efficient management of large projects"
(Nucleic Acids Research, in press)
The need for storing extra information in project databases has
resulted in the creation of two files. For users who wish you use old
(sap) databases with xdap, additional files must be created to use all
the new features. The program 'convert_project' does this. It is
interactive, and asks you for names of relevant files, version numbers
etc. Here is a sample program dialogue:
% convert_project
Database conversion program
Converts *.RD? file to *.TG? and *.CC? files
Project name ? test
Version ? 0
Conversion completed.
Further, please ensure that the file TAGDB is in your project
directory. Copies can be found in $STADTABL. Alternatively ensure that
the environment TAGDB variable is set to $STADTABL/TAGDB
setenv TAGDB $STADTABL/TAGDB

30
doc/README Normal file
View file

@ -0,0 +1,30 @@
Processing and printing LaTeX sources
-------------------------------------
Given a source file src.tex, run LaTeX to generate the bibliographic
references:
latex src
Now run BibTeX to search the bibliography for them:
bibtex src
Now run LaTeX twice, first to pick up the references, second to bind
forward references:
latex src
latex src
This will have generated a src.dvi output file. Now we convert this
to PostScript:
dvi2ps src.dvi >src.ps
Now we can print this out:
lpr src.ps
Most of the above is only necessay if you are building something from
scratch, but it's best to go through it anyway until you fully
understand how LaTeX works.

131
doc/gip-menu.PS Normal file
View file

@ -0,0 +1,131 @@
%!
/cm {28.2 mul} def
/BOXSIZE 2 cm def
/boxcen
{
% move to centre of box
BOXSIZE mul 2 div BOXSIZE 2 div rmoveto
exch
% move back by correct amount to ensure letter is in centre of box
dup stringwidth
pop 2 div neg % halve & neg x offset
% y offset appears to be zero! - so use constant 'square' char (eg X)
(X) stringwidth pop 2 div neg
} def
/letter
{
dup BOXSIZE mul 0 rlineto
0 BOXSIZE rlineto
dup BOXSIZE mul neg 0 rlineto
0 BOXSIZE neg rlineto
closepath
gsave
dup boxcen rmoveto
show
stroke
grestore
BOXSIZE mul 0 rmoveto
} def
/nextline {0 BOXSIZE neg rmoveto} def
/line
{
gsave
1 letter
1 letter
1 letter
1 letter
grestore
nextline
} def
/Times-Roman findfont 50 scalefont setfont
newpath
5 setlinewidth
200 650 translate
0 0 moveto
%2 setlinecap
gsave
(A) (G) (C) (T) line
(3) (4) (1) (2) line
(B) (H) (D) (V) line
(M) (N) (K) (L) line
(-) (X) (Y) (R) line
(8) (7) (6) (5) line
/Times-Roman findfont 25 scalefont setfont
gsave
(DELETE) 2 letter
(RESET) 2 letter
grestore
nextline
/Times-Roman findfont 35 scalefont setfont
gsave
(STOP) 4 letter
grestore
nextline
gsave
(START) 4 letter
grestore
nextline
gsave
(CONFIRM) 4 letter
grestore
nextline
% yukky from here on
gsave
0 BOXSIZE rmoveto
1 cm 0 rlineto stroke
grestore
(ORIGIN) dup 4 boxcen rmoveto show pop
(ORIGIN) stringwidth neg exch neg exch rmoveto
(X) stringwidth exch 2 div rmoveto
-5 0 rmoveto
2 setlinewidth
-45 21 rlineto
6 0 rlineto
-6 0 rmoveto
0 -6 rlineto
stroke
grestore
2 setlinewidth
0 BOXSIZE 1.4 mul rmoveto
6 6 rlineto
-6 -6 rmoveto
6 -6 rlineto
-6 6 rmoveto
80 0 rlineto
5 -6 rmoveto
/Times-Roman findfont 30 scalefont setfont
(8 cm) show
5 6 rmoveto
76 0 rlineto
-6 6 rlineto
6 -6 rmoveto
-6 -6 rlineto
stroke
0 0 moveto
BOXSIZE .4 mul neg BOXSIZE rmoveto
currentpoint translate
newpath
0 0 moveto
90 rotate
-6 6 rlineto
6 -6 rmoveto
-6 -6 rlineto
6 6 rmoveto
-244 0 rlineto
-84 0 rmoveto
0 -6 rmoveto
(20 cm) show
0 6 rmoveto
-84 0 rmoveto
-227 0 rlineto
6 6 rlineto
-6 -6 rmoveto
6 -6 rlineto
stroke
showpage

2426
doc/install.PS Normal file
View file

File diff suppressed because it is too large Load diff

172
doc/install.tex Normal file
View file

@ -0,0 +1,172 @@
\documentstyle[a4,11pt]{article}
\title{Installing the Staden Package}
\author{Simon Dear}
\date{21 May 1993}
\begin{document}
\maketitle
\section{Introduction}
On the accompanying tape you will find executables for
one of SunOS 4.x, Sun
Solaris 2.x, DEC Ultrix, DEC OSF/1 and Silicon Graphics SGI operating systems.
Also there are sources for all the programs in the Staden package.
Programs in the package are:
\begin{description}
\item[mep and xmep] Motif exploration program.
\item[nip and xnip] Nucleotide interpretation program.
\item[nipl] Nucleotide interpretation program (library).
Searches nucleotide libraries for patterns of motifs.
\item[pip and xpip] Protein interpretation program.
\item[pipl] Protein interpretation program (library).
Searches protein libraries for patterns of motifs.
\item[sip and xsip] Similarity investigation program.
\item[sipl] Similarity investigation program (library).
Compares a probe protein or nucleic acid sequence against
a library of sequences.
\item[sap and xsap] The original sequence assembly program.
\item[bap and xbap] Our latest, most advanced sequence assembly program.
\item[dap and xdap] An obsolete assembly program, superceded by {\em bap}.
\item[lip] Library interface program.
\item[rep] Repeat examination program.
\item[ted] X windows utility for displaying and editing
fluorescent sequencing machine traces.
\item[splitp1, splitp2 and splitp3] Refer to help/SPLITP.MEM.
\item[sethelp] Builds online help files.
\item[gip] Gel input program.
\item[convert] Converts between {\em xdap\/} and {\em xbap\/} databases.
\item[cop and cop-bap] Checks completed {\em xdap\/} and {\em xbap\/}
databases for editing errors.
\item[trace2seq] Extracts sequence from trace files.
\item[getABISampleName] Extracts sample names from ABI trace files.
\item[makeSCF] Converts existing trace files to the compact
SCF format.
\item[alfsplit] Splits the Pharmacia A.L.F. gel
file into multiple files, one for each sample.
\item[frog] Relabels lanes in ABI trace files.
\item[+ numerous scripts (including {\em squirrel (v1.4)\/})]
\end{description}
\section{Requirements}
You will need a tape drive to read the software off the distribution
tape (QIC-150, TK50, or Exabyte). You will also need a large amount of
disk storage to accommodate the whole package. For release
version-1993.0, requirements were
31Mb (SunOS 4.x),
36Mb (Sun Solaris 2.x)
30Mb (DEC Ultrix)
37Mb (DEC OSF/1)
and
27Mb (Silicon Graphics SGI.)
To compile the Staden package you will require:
\begin{itemize}
\item An ANSI C compiler.
\item A FORTRAN-77 compiler.
\item X11 (Release 4 or 5).
\item GNU make (except with SunOS and Solaris 2.x.)
\end{itemize}
\section{Installation}
To install the package,
\begin{enumerate}
\item Create a directory for where you would like the software to be
placed. You may have to be superuser to do this.
\begin{verbatim} mkdir /home/Staden\end{verbatim}
\item Change to this directory.
\begin{verbatim} cd /home/Staden\end{verbatim}
\item Place the tape into the tape unit.
\item Extract the software off the distribution tape (NOTE: the device name may be
different on your machine):
\begin{verbatim} tar xvf /dev/rst0\end{verbatim}
\item C shell users should set the environment variable {\bf STADENROOT}
to be the directory where the package is installed and source the file
{\em staden.login} found there. This is best done by adding lines to their
{\em .login} file:
\begin{verbatim}
setenv STADENROOT /home/Staden
source $STADENROOT/staden.login
\end{verbatim}
Users of the Bourne shell, sh, should similarly add lines their {\em .profile} file:
\begin{verbatim}
STADENROOT=/home/Staden
export STADENROOT
. $STADENROOT/staden.profile
\end{verbatim}
The startup routines set environment variables and modify the shell's
search path so that it can find the programs in the Staden Package.
When users next log on to the system, they will be able to use the
programs.
\end{enumerate}
\section {Installation on Unsupported Platforms}
Install the software as you would for a supported machine. You will
need to remake all executables. The script {\em Staden\_install} can
be used to help recompile the package. A large number of
assumptions have been made, and you may need to change the makefiles
to suit your system.
The sources have been organised into subdirectories of the directory
{\bf src}. In {\bf Misc} are routines common to many programs. They
should be made first. In {\bf staden} are all the programs of the
Staden suite ({\em mep}, {\em nip}, {\em pip}, {\em sap}, {\em sip},
{\em dap}, {\em gip}, {\em vep}, {\em lip} and {\em rep}) with the
exception of {\em bap}. Code for our latest sequence assembly program
{\em bap} is in directories {\bf bap} and {\bf bap/osp-bits}. Make
the objects in {\bf staden} first, then the ones in {\bf
bap/osp-bits}, and finally the ones in {\bf bap}. In {\bf ted} is the
trace editing program.
\section {Other Software Provided}
Other software and scripts can be found in the {\bf alf\/}, {\bf
abi\/}, {\bf cop\/}, {\bf getMCH\/}, {\bf scf\/}, {\bf frog\/} and {\bf
scripts}
directories.
Each directory contains documentation describing the programs
contained.
Since release version-1993.0 we have distributed the {\em squirrel (v1.4)}
package. Please read the disclaimer that accompanies this software.
Additional sources and scripts can be found in {\bf expGetSeq}, {\bf vepe},
{\bf newted} and {\bf squirrel-1.4} directories.
Many scripts (including {\em squirrel}) and filters were developed at the MRC-LMB for
{\bf INTERNAL USE ONLY}.
We are aware that people elsewhere will want to develop
similar software.
We include them in the Staden Package merely as {\bf EXAMPLES} of
what has been achieved elsewhere.
{\bf THESE SCRIPTS WILL NOT WORK ON YOUR SYSTEM WITHOUT MODIFICATION.}
\section {When All Else Fails...}
If you have any problems please contact the authors,
\mbox{Rodger Staden}
\mbox{(\em rs@mrc-lmba.cam.ac.uk\/)},
\mbox{Simon Dear}
\mbox{(\em sd@mrc-lmba.cam.ac.uk\/)}
and
\mbox{James Bonfield}
\mbox{(\em jkb@mrc-lmba.cam.ac.uk\/)},
by email or by writing to us at:
MRC Laboratory of Molecular Biology, Hills Road, Cambridge, \mbox{CB2 2QH}, U.K.
We also welcome general comments on the package.
\end{document}

5154
doc/manual.rtf Normal file
View file

File diff suppressed because it is too large Load diff

3033
doc/ted.PS Normal file
View file

File diff suppressed because it is too large Load diff

213
doc/ted.tex Normal file
View file

@ -0,0 +1,213 @@
\documentstyle[12pt]{article}
\title{A trace display and editing program for data from fluorescence based
sequencing machines}
\author{Timothy Gleeson \and LaDeana Hillier}
\begin{document}
\maketitle
\section*{}
\subsection*{}
\subsubsection*{ABSTRACT}
``Ted'' ({\em T}race {\em ed}itor)
is a graphical editor for sequence and trace data from automated
fluorescence sequencing machines. It provides facilities
for viewing sequence and trace data (in top or bottom strand
orientation), for editing the base sequence, for
automated or manual trimming of the head (vector) and tail
(uncertain data) from the sequence, for vertical and horizontal trace
scaling, for keeping a history of sequence editing, and for output of
the edited sequence. Ted has been used extensively in the C.
elegans genome sequencing project,
both as a stand-alone program and integrated into
the Staden sequence assembly package, and has
greatly aided in the efficiency
and accuracy of sequence editing. It runs in the X
windows environment on Sun workstations and is available from the
authors. Ted currently supports sequence and trace data from the ABI
373A and Pharmacia A.L.F. sequencers.
\subsubsection*{INTRODUCTION}
Time involved in sequence editing is extensive, and anything easing
that burden will improve the efficiency of any major sequencing
project. Having sequence and trace data available online in easily-
manipulable form is invaluable. Ted (a Trace-EDitor) was developed to
fill this role in the C. elegans genome
sequencing project [1].
\subsubsection*{METHODS}
{\em Computing Design and Implementation.}
When designing ted, we had a number of specific computing goals
in mind including portability and adaptability. For portability, we
chose to write ted in ANSI C using the X windowing system and the
Xaw toolkit. X provides basic capabilities for the creation and use
of windows, and the toolkit contains a number of pre-packaged
components, such as the ``sliders'' used for scrolling. X also allows
site, user and per-run defaults to be set. Adaptability is also an
important goal since we are providing a new function to
research groups who are constantly adding new requirements.
Stylistically, we have followed an ``Abstract Data Type''
discipline. In this discipline, a program is split into a number of
modules which provide separate, well-defined functions. We
separate the interface of a module from its implementation. For
example, a unified internal sequence format is used. This can store
a varying amount of information. However, there is a clear and
simple interface by which the rest of the program accesses this
module. Such a style is not well supported by C, but its adoption has
been very successful. The addition of new sequencing machines, and
thus new external data formats, may cause some changes in the
internal representation of the sequence but should not affect
the rest of the program.
Ted accepts a large number of optional command line arguments,
many of which can also be specified as system defaults. This
supports a mode of working whereby ted is invoked not directly by the
user but instead by a script or another application which supplies
arguments appropriate to the editing task.
{\em Graphical Interface.}
Ted currently accepts data from two fluorescence based sequencing
machines, the Pharmacia A.L.F. and the ABI 373A.
The sequencing machine data consists of
four traces of fluorescence levels together with the machine's
interpretation, which is a sequence of bases.
Ted displays
the traces and the machine-generated base list.
A second, initially identical, list of bases is provided for correction
by the user.
Ted has an X windows based
graphical interface. The trace file
can either be input from the command line or by
clicking on the INPUT button after the program has been invoked.
Other parameters which the user may specify on the
command line include: the output
file name; a base position or sequence string on which the trace is
to be centered; a default trace magnification; a 5' vector sequence
for automated elimination of the sequence head (vector); top or
bottom strand orientation; or any of the usual X-window parameters (e.g.
display, geometry...).
The graphics display (Figure 1) consists of the control
panel, the base position information, the original and edited sequence
data, and the graphical representation of the trace. The user may
begin by using the control panel INPUT button to input a new trace
file at which time the user selects whether to view the sequence
and trace in top or bottom strand orientation.
The trace file is displayed and, if a 5' vector sequence has been
specified on the command line, the program attempts to select a
cutoff point corresponding to the vector sequence at the ``head'' of the
trace file. The bases beyond the ``cutoff'' point are
displayed on a shaded background. The user may modify the cutoff
position by clicking on the ``Adj left cut'' button and clicking on the
position of the desired cutoff. Similarly, the user may adjust the
right cutoff of the sequence (chosen by starting at the 5' end of the
sequence and looking for the first occurrence when 2 out of 5 bases
are 'N') by scrolling along the sequence to that point, clicking on the
``Adj right cut'' button, and clicking on the appropriate base.
Automation of the ``cutoff'' process is optional; the user may compile
the program with that feature turned ``off.''
Clicking on the ``Edit seq'' button allows the user to enter the edit
mode. The ``Search'' button can be used to skip from ``problem'' to
``problem'' (i.e., ambiguity to ambiguity) or to look for runs of
identical bases (e.g., TTTT) which are often mis-called by
the machine software.
Bases can be inserted, deleted, or replaced as with
any ordinary word-processor. In difficult-to-read areas,
the trace may be vertically or horizontally scaled by dragging or
clicking on the magnification scroll bar or by clicking on the
vertical scaling buttons (``Scale down'', ``Scale up''), respectively.
Finally, the edited sequence is saved to an ascii file using the
``Output'' button. A history of the editing session can also be saved
along with the sequence.
The ``Quit'' button is used
to exit the program. When reinvoking ted on an edited trace file the
edited base sequence, rather than the original sequence, is shown in
the edited base window. The user may invoke ted by calling in any one
of the previous editing sessions.
\subsubsection*{APPLICATIONS AND CONCLUSIONS}
In the C. elegans genome sequencing project, data from the ABI or
A.L.F. sequencing machines' computers are transferred to Sun
workstations.
The user invokes a Unix shell script that calls ted systematically
on each of the new set of trace files creating a set of sequence files.
The sequence files that are deemed to be of acceptable quality
are then entered into the sequence
assembly program xdap [2] where the sequences are assembled into
contigs. Portions of the ted trace-editor have been incorporated
into the xdap ``trace manager,'' which is used in
conjunction with the contig editor to view sets of aligned traces
at sites of discrepancies in the aligned sequences.
Ted is also used at the stage of choosing oligo primers for the
``walking'' stage of the sequencing project. It can be invoked directly
from the oligo selection program, osp [3], to allow examination
of the trace data in the region of the primers so that
integrity of the sequence data can be verified.
Currently, no other programs are known to be available
which support editing of the ABI trace data.
Further, the modular design of the program should allow
support for new types of sequencing machines, with new data
formats, to be implemented in a straightforward fashion.
\subsubsection*{AVAILABILITY}
Ted is freely available from the authors or from Rodger Staden and
Simon Dear (MRC Laboratory of Molecular Biology, Hills Road, Cambridge,
UK, CB2 2QH) for use on Sun workstations running X-windows (or OpenLook).
\subsubsection*{ACKNOWLEDGMENTS}
The authors would like to thank all members of the C. elegans
sequencing project with special thanks to the following people:
John Sulston, Bob Waterston,
Phil Green, Rick Wilson, Richard Durbin, Simon Dear, and Rodger Staden
for their helpful suggestions for improvements in the ted interface
and for their parts in the development of ted. This work was
supported by the Medical Research Council and NIH grant R01-HG00136.
\subsubsection*{REFERENCES}
1. Waterston, R., Sulston, J., et al. (1991), in preparation.
2. Dear, S. and Staden, R. (1991) Nuc. Acids Res., in press.
3. Hillier, L. and Green, P. (1991) submitted.
{\bf Figure 1 legend.}
Figure 1 shows a ``screen dump'' of the ted graphical interface.
The display consists of
the control panel and the synchronized view of the base position
information, original and edited sequence data,
and graphical representation of the trace (with each nucleotide's trace
being represented
by a different color). The control
panel allows the user to read in new trace files (in either
bottom or top strand orientation)
as well as to search for a string of nucleotides or a certain base position.
Scroll bars allow the user to adjust the magnification of or scroll through
the sequence and trace data. The user may also choose to change the vertical
magnification of the trace data. Further, sequence on the head (vector)
or tail (uncertain data) of the sequence may be ``cutoff''
using the adjust left and right cutoff buttons. Bases can be inserted,
deleted, or replaced as with
any ordinary word-processor in the sequence data window. Finally, the
sequence may be written to an ascii file using the output button on
the control panel.
\end{document}

2722
help/BAP.RNO Normal file
View file

File diff suppressed because it is too large Load diff

2724
help/DAP.RNO Normal file
View file

File diff suppressed because it is too large Load diff

205
help/GIP.RNO Normal file
View file

@ -0,0 +1,205 @@
.NPA
.left margin1
.CENTER
GIP
.LEFT MARGIN1
.PARA
A digitizer is
a two dimensional surface
which is such that if a special pen is pressed onto it, the pens
coordinates can be recorded by a computer.
These coordinates
can be interpreted by a program.
.para
The digitizing device we use works by the pen emitting a high frequency
sound which is picked up by two microphones positioned at the rear of the
working area. The pen position is determined by triangulation and the
digitizing device sends the coordinates to the computer. As no special
surface is required the device can conveniently be positioned on a light
box giving the sequencer an unobscured view of the autoradiographs.
.LEFT MARGIN1
The digitizer
is called a GRAPHBAR MODEL GP7 made by
Science Accessories Corp,
970 Kings Highway West,
Southport,
Connecticut 06490,
USA.
.para
The program uses a menu to allow the user to select commands or
to enter the uncertainty codes for areas of the gel that are
difficult to interpret. A menu is simply a series of boxes drawn on
the digitizing surface that each contain a command or
uncertainty code. When the user puts the pen down in these special
regions the program interprets the coordinates as commands and acts
appropriately. A copy of the menu should have been sent to you.
It should be stuck down on the surface of the
light box in the digitizing area. For convenience it is best to position it
to the right of the digitizing area, but in practice as long as
its top
edge is parallel to the digitizer box, it can be put anywhere in the active
region.
.sk1
.left margin1
Entering gel readings using a digitizer
.left margin1
.para
The autoradiograph should be stuck down on the light box with the lanes
running, as near is as
possible, at right angles to the digitizer. To read
an autoradiograph placed on the light box
the user need only define the positions of
the four sequencing lanes and the bases
to which they correspond and then use the pen to point to each
successive band progressing up the gel. The program examines the
coordinates of each pen position to see in which of the four
lanes
it lies and assigns the corresponding base to be stored in the
computer. Each time the pen tip is depressed to point to a position
on the surface of the digitizer the program sounds the bell on the
terminal (a different sound for each of the four bases on the
microcomputer version of the program)
to indicate to the user that a point has been recorded. As
the sequence is read the program displays it on the screen.
.para
The program uses a menu
to allow the user to select commands or
to enter the uncertainty codes for areas of the gel that are
difficult to interpret. A menu is simply a series of boxes drawn on
the digitizing surface that each contain a command or
uncertainty code. When the user puts the pen down in these special
regions the program interprets the coordinates as commands and acts
appropriately. As well as the uncertainty codes
A,C,G,T,1,2,3,4,B,D,H,V,R,Y,X,-,5,6,7,8 the following commands are
included in the menu: DELETE removes the last character from
the sequence;
RESET allows the lane centres to be redefined;
START means begin the next
stage of the procedure; STOP means stop the current stage in the
procedure; CONFIRM means confirm that the last command or set of
coordinates are correct.
.para
The digitizing device also has a menu of its own. This lies in a two inch wide
strip immediately in front of the digitizing box. Pen positions within this
two inch strip are interpretted as commands to the digitizer and are not
sent to the GIP program. In general the only time users will need to use
the device menu is when they tell GIP where the program menu lies in the
digitizing area. This is done by first hitting ORIGIN in the device menu
and then hitting the bottom left hand corner of the program menu. The
program menu can hence be positioned anywhere in the active region but
should be arranged parallel to the digitizer.
.para
The user should try to hit the bands as near as possible to the centre of
the lanes because the program tracks the lanes up the film using the pen
positions. By using this tracking strategy the user only has to define the
centres of the bottom of the lanes before starting to read the film. The
program can correctly follow quite curved lanes and constantly checks that
its lane centre coordinates look sensible. If the lane centres appear to be
getting too close the program stops responding to the pen positions of
bands and hence does not ring the bell. If this occurs users must hit the
reset box in the menu and the program will request them to redefine the
lane centres at the current reading position. Then they can continue
reading. As a further safeguard the program will only respond to pen
positions either in the menu or very close to the current reading position.
.sk1
.left margin1
Running the gel reading program
.left margin1
The autoradiograph should be firmly stuck down on the light box and the
program started by typing GIP. It will ask the first question.
.left margin2
" ? FILE OF FILE NAMES="
.left margin2
Type the name for the file of file names and then follow the instructions.
.left margin2
" HIT DIGITIZER MENU ORIGIN"
.left margin2
" THEN PROGRAM MENU ORIGIN"
.left margin2
" THEN HIT START IN PROGRAM MENU"
.left margin2
If the bell does not sound after you hit start try hitting metric in the
device menu (the program uses metric units, and some digitizers are set to
default to use inches; hitting metric switches between the two).
.left margin2
After the bell has sounded the program will give the default lane order.
.left margin2
" LANE ORDER IS T C A G"
.left margin2
" IF CORRECT HIT CONFIRM, ELSE HIT RESET"
.left margin2
If the lane order, reading from left to right is correct hit confirm in the
program menu. If you are using a different order hit reset and you will be
asked to define the lane order from left to right using the program menu
(as follows).
.left margin2
" DEFINE LANE ORDER (LEFT TO RIGHT) USING MENU"
.left margin2
Hit the boxes in the menu that contain the symbols A,C,G,T in the
left-right order of the lanes. The program will respond with the lane order
as above and ask for confirmation. When this is received, the next task is
to define the start positions of the next four lanes.
.left margin2
" HIT START, THEN HIT (LEFT TO RIGHT)"
.left margin2
" THE START POSITIONS FOR THE NEXT FOUR LANES"
.left margin2
Hit the centres of the four lanes at a height level with the first band
that is going to be read. The program will report the mean lane separations
and asks for confirmation that they are correct.
.left margin2
" MEAN LANE SEPARATION IS XX"
.left margin2
" HIT CONFIRM TO CONTINUE"
.left margin2
Users will become familiar with the values from their films and will spot
any unusual numbers.
Asking for confirmation allows users to try again if they had made a
mistake, but generally the lane separation values can be ignored.
Hit confirm, and the program will give the message
.left margin2
" HIT START WHEN READY TO BEGIN READING"
.left margin2
Hit start and the program will give the message
.left margin2
" HIT BANDS, UNCERTAINTY CODES, RESET OR STOP"
.left margin2
Hit the bands, interpretting the sequence progressing
up the film. If necessary use the uncertainty codes. If the pen stops
responding hit reset and follow the instructions as above. When the
sequence becomes unreadable hit stop and the program will ask for a file
name for the gel reading just read.
.left margin2
" ? FILE NAME FOR THIS GEL READING="
.left margin2
Type the file name observing the rules about legal gel readings names.
The program will ask if you wish
to read another sequence.
.left margin2
" TO ENTER ANOTHER GEL READING TYPE 1"
.left margin2
To enter another type 1 and you will be back to the step of defining the
lane order. Typing anything else will stop the program.
.left margin1
.sk1
Running the microcomputer version of the gel reading program
.left margin1
The microcomputer version of GIP is slightly different and is called
GIPB. The BBC micro
does not have the capacity to process the gel readings beyond the reading
stage.
This means that users of this program
would need to transfer their gel readings from the micro to another machine
using a terminal emmulator. Transferring many files is tedious and so the
microcomputer version of the gel reading program stores all the gel
readings for each run of the program in a single file. This special
file contains both sequences and file names and can be moved in a single
transfer to another machine. Once on the other machine the single file must
be split into separate gel reading files and a file of file names. This is
done using the program BSPLIT. As far as using the microcomputer version
of GIP, the only difference is that the first file name the program
requests is not a file of file names, but a name for the single file to
contain all the gel readings and their names.

859
help/MEP.RNO Normal file
View file

@ -0,0 +1,859 @@
.NPA
.SP 1
.left margin1
@-1. TX 0 @General
.sp
@-2. T 0 @Screen control
.sp
@-2. X 0 @Screen
.sp
@-3. TX 0 @Dictionary analysis
.sp
@0. TX -1 @MEP
.left margin2
.para
This is a program for analysing families of nucleotide sequences in order
to find common motifs and potential binding sites.
The ideas in this program were described in Staden, R. "Methods
for discovering novel motifs in nucleic acid sequences".
Computer Applications in the Biosciences, 5, 293-298, (1989).
.PARA
The program can read
sequences stored in either of two formats: 1) all sequences aligned in a
single file; 2) all sequences in separate files and accessed through a file
of file names.
.PARA
The program contains functions that can answer several questions
about a set of sequences:
.SK1
.left margin2
Which words are most common?
.left margin2
Which words occur in the most sequences?
.left margin2
Which words contain the most information?
.left margin2
Which words occur in equivalent positions in the sequences?
.left margin2
Which words are inverted repeats?
.left margin2
Which words occur on both strands of the sequences?
.left margin2
Where are the inverted repeats?
.left margin2
Where are the fuzzy words?
.para
Most of the program is
concerned with analysing
what it terms "fuzzy
words" within the set of sequences. The analysis is explained
below. Note that the standard version of the programs is limited
to words of maximum length 8 letters, and a maximum fuzziness
of 2.
.para
The following analyses (preceded by their option numbers) are included:
.lit
? = Help
! = Quit
3 = Read new sequences
4 = Redefine active region
5 = List the sequences
6 = List text file
7 = Direct output to disk
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Reset margins
15 = Label diagram
16 = Draw map
17 = Search for strings
18 = Set strand
19 = Set composition
20 = Set word length
21 = Set number of mismatches
22 = Show settings
23 = Make dictionary Dw
24 = Make dictionary Ds
25 = Make fuzzy dictionary Dm from Dw
26 = Make fuzzy dictionary Dm from Ds
27 = Make fuzzy dictionary Dh from Dm
28 = Examine fuzzy dictionary Dm
29 = Examine fuzzy dictionary Dh
30 = Examine words in Dm
31 = Examine words in Dh
32 = Save or restore a dictionary
33 = Find inverted repeats
.end lit
.para
Some of these methods produce graphical
results
and so the
program is generally used from a graphics terminal (a vdu on which lines
and points can be drawn as well as characters).
.para
.LEFT MARGIN2
The positions of each of the plots is defined relative to a users drawing
board which has size 1-10,000 in x and 1-10,000 in y.
Plots for
each option are drawn in a window defined by x0,y0 and xlength,ylength.
Where x0,y0 is the position of the bottom left hand corner of the window,
and xlength is the width of the window and ylength the
height of the window.
.lit
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
.end lit
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "MEPMARG" when the
program is started. Users can have their own file if required.
.para
The options for the program are accessed from 3 main menus: general, screen
control and dictionary analylsis.
Both menus and options are selected by number.
.para
The most important and novel part of the program is its use of "fuzzy
dictionaries" and an information theory measure, to help show the most
interesting motifs.
Central to the method is the idea of a fuzzy dictionary of word
frequencies. A dictionary of word frequencies is an ordered list of
all the words in the sequences and a count of the number of times
that they occur. A fuzzy dictionary is an equivalent list but which
contains instead, for each word, a count of the number of times
similar words occur in the sequences. We term words that are
similar "relations". The fuzziness is defined by the number of
letters in a word that are allowed to be different. So if we had a
fuzziness of 1 we allow 1 letter to be different. For example, with
a fuzziness of 1, the entry in the fuzzy dictionary for the word
TTTTTT would contain a count of the numbers of times TTTTTT
occured plus the number of times all words differing by exactly
one letter from TTTTTT occured.
.para
Once the fuzzy dictionary has been created we can examine it in
several ways to find candidate control sequences. The simplest
question we can ask is which word in the dictionary is the most
common. Sometimes this simple criterion of "most common" may
be adequate to discover a new motif but in general we would not
expect it to be sufficient. For example some words will be common
simply because of a base composition bias in the sequences being
analysed. In addition a word can be the most frequent and yet not
be "well defined". This last point is best explained by an example.
.para
Suppose we were looking at two letter words and allowing one
mismatch, and that there were 10 occurences of TT and 5 of AC.
We could align the 10 words that were one letter different from TT
and the 5 that were related to AC. Then we could count the
number of times each base occured in each position for each of
these two sets of words. Suppose we got the two base frequency
tables shown below.
.lit
TT AC
T 6 4 T 1 0
C 1 3 C 0 4
A 1 2 A 4 1
G 2 1 G 0 0
.end lit
These tables show that although TT occurs (with one letter
mismatch) more often than AC, the ratio of base frequencies for
AC at 4/5, 4/5 is higher than those for TT at 6/10, 4/10. Hence we
would say that AC was better defined than TT.
Expressing this another way we would say that the definition of AC
contained more information than that for TT. The program
calculates the information content in a way that takes into account
both the sequence composition and the level of definition of the
motif.
.para
Definitions
.para
Here we deal only with the dictionary analysis.
Suppose we are dealing with a set of
sequences and are examining them for words that are six
characters in length.
.para
Dictionary Dw contains a count of the number of times each word
occurs in the set of sequences. For example the entry for TTTTTT
contains a value equal to the number of times the word TTTTTT
occurs in the set of sequences.
.para
Dictionary Ds contains a count of the number of different sequences in
which each word occurs. For example if the entry for word TTTTTT
contains the value 10, it denotes that the word TTTTTT occurs in ten
different sequences. Unlike Dw it only counts words once for each
sequence. For example if we had a set of 100 sequences, the maximum
possible value that Ds could take is 100, and this would only happen if
a word occurred in every sequence. However for the same set of
sequences, Dw could contain values greater than 100, and this would
show that a word had occurred more than once in at least one
sequence.
.para
From either of the two dictionaries Dw or Ds we can calculate a fuzzy
dictionary Dm. For each word, the entry in the fuzzy dictionary Dm
contains the sum of the dictionary values (taken from either Dw or Ds)
for all words that differ from it by up to m letters. For example if m=2
the entry for TTTTTT contains the number of times that TTTTTT
occurs in the dictionary, plus the counts for all words that differ from
TTTTTT by 1 or 2 letters.
Obviously the interpretation of the values in Dm depends on which of
the two dictionaries Dw or Ds they were derived from. When derived
from Dw the entry for any word in Dm gives the total number of
times it, and its relations, occur in the set of sequences. When derived
from Ds the entry for any word in Dm gives the total number of
different sequences that contain a word and each of its relations.
.para
Finally, from fuzzy dictionary Dm we can derive fuzzy dictionary Dh.
All entries in Dh are zero except for the word(s), within each set of
relations, that are most frequent. For example if TTTTTT occurred 20
times but had a relation that occurred more often, then the entry for
TTTTTT would be zero. However if TTTTTT did not have a more
frequently occurring relation, then the entry for TTTTTT would
contain the value 20.
.LEFT MARGIN1
@1. T 0 @Help
.LEFT MARGIN2
.para
This option gives online help. The user should select option numbers and
the current documentation will be given. Note that option 0 gives an
introduction to the program, and that ? will get help from anywhere in
the
program.
The following analyses (preceded by their option numbers) are included:
.lit
? = Help
! = Quit
3 = Read new sequences
4 = Redefine active region
5 = List the sequences
6 = List text file
7 = Direct output to disk
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Reset margins
15 = Label diagram
16 = Draw map
17 = Search for strings
18 = Set strand
19 = Set composition
20 = Set word length
21 = Set number of mismatches
22 = Show settings
23 = Make dictionary Dw
24 = Make dictionary Ds
25 = Make fuzzy dictionary Dm from Dw
26 = Make fuzzy dictionary Dm from Ds
27 = Make fuzzy dictionary Dh from Dm
28 = Examine fuzzy dictionary Dm
29 = Examine fuzzy dictionary Dh
30 = Examine words in Dm
31 = Examine words in Dh
32 = Save or restore a dictionary
33 = Find inverted repeats
.end lit
.left margin1
@2. T 0 @Quit
.left margin2
.para
This function stops the program.
.left margin1
@3. TX 1 @Read a new sequence
.LEFT MARGIN2
.para
It can read
sequences stored in either of two formats: 1) all sequences aligned in a
single file; 2) all sequences in separate files and accessed through a file
of file names. Typical dialogue follows:
.lit
X 1 Read file of aligned sequences
2 Use file of file names
? 0,1,2 =
? File of aligned sequences=F1
Number of files 88
.end lit
.left margin1
@4. TX 1 @Define active region
.LEFT MARGIN2
.para
For its analytic functions
the program always works on a region of the sequence called the active
region. When new sequences are read into the program the active region is
automatically set to start at the beginning of the sequences and go
up to the end of the longest one.
.left margin1
@5. TX 1 @List a sequence
.LEFT MARGIN2
.para
The sequence can be listed with line lengths of 50 bases with each sequence
numbered in the order in which they were read.
Output can be directed to a disk file by
first selecting disk output. Typical dialogue follows.
.lit
? Menu or option number=5
10 20 30 40 50
1 TAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCA
2 CAAATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTAC
3 TAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTATT
4 ACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTA
5 AGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
6 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGC
7 ACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCG
8 GGGGCAAGGAGGATGGAAAGAGGTTGCCGTATAAAGAAACTAGAGTCCGT
9 AGGGGGTGGAGGATTTAAGCCATCTCCTGATGACGCATAGTCAGCCCATC
10 AAAACGTCATCGCTTGCATTAGAAAGGTTTCTGGCCGACCTTATAACCAT
60
1 TACCCGTTTTT
2 GCGTTTTTGT
3 TCATACCATAAG
4 TTTCATACC
5 ATTGTGAGC
6 TTCCGGCTCG
7 GAAGAGAGT
8 TCAGGTGT
9 ATGAATG
10 TAATTACG
.end lit
.left margin1
@6. TX 1 @List a text file
.LEFT MARGIN2
.para
Allows the user to have a text file displayed on the screen. It will appear
one page at a time.
.left margin1
@7. TX 1 @Direct output to disk
.LEFT MARGIN2
.para
Used to direct output that would normally appear on the screen to a file.
.para
Select redirection of either text or graphics, and
supply the name of the file that the output should be written to.
.para
The results from the next options selected will not appear on the screen
but will be written to the file. When option 7 is selected again
the file will be
closed and output will again appear on the screen.
.left margin1
@10. TX 2 @Clear graphics
.LEFT MARGIN2
.para
Clears the screen of both text and graphics.
.left margin1
@11. TX 2 @Clear text
.LEFT MARGIN2
.para
Clears only text from the screen.
.left margin1
@12. TX 2 @Draw a ruler
.LEFT MARGIN2
.para
This option
allows the user to draw a ruler or scale along the x axis of the screen to
help identify the coordinates of points of interest. The user can define
the position of the first amino acid to be marked (for example if the
active
region is 1501 to 8000, the user might wish to mark every 1000th amino
acid
starting at either 1501 or 2000 - it depends if the user wishes to treat
the active region as an independent unit with its own numbering starting
at
its left edge, or as part of the whole sequence). The user can also define
the separation of the ticks on the scale and their height. If required the
labelling routine can be used to add numbers to the ticks.
.left margin1
@13. TX 2 @Use crosshair
.LEFT MARGIN2
.para
This function puts
a steerable cross on the screen that can be used to find the
coordinates of points in the sequence. The user can move the cross
around using the directional keys; when he hits the space bar the
program will print out the coordinates of the cross in sequence units and
the option will be exited.
.para
If instead,
you hit a , the position will be displayed but the cross will remain on
the screen.
.para
If a letter s is hit the sequence around the cross hair is displayed and
the cross remains on the screen.
.left margin1
@14. TX 2 @Reposition plots
.LEFT MARGIN2
.para
The positions of each of the plots is defined relative to a users drawing
board which has size 1-10,000 in x and 1-10,000 in y.
Plots for
each option are drawn in a window defined by x0,y0 and xlength,ylength.
Where x0,y0 is the position of the bottom left hand corner of the window,
and xlength is the width of the window and ylength the
height of the window.
.lit
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
.end lit
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "MEPMARG" when the
program is started. Users can have their own file if required.
As all the plots start
at the same position in x and have the same width, x0 and xlength are the
same for all options. Generally users will only want to change the start
level of the window y0 and its height ylength.
This option
allows users to change window positions whilst running the program.
The routine prompts first for the number of the option that the users
wishes
to reposition; then for the y start and height; then for the x start and
length. Note that changes to the x values affect all options. If the user
types only carriage return for any value it will remain unchanged.
The cross-hair can be used to choose suitable heights.
.LEFT MARGIN1
@15. TX 2 @Label a diagram
.LEFT MARGIN2
.para
This routine allows users to label any diagrams they have produced. They
are asked to type in a label. When the user types carriage return to finish
typing the label the cross-hair appears on the screen. The user can
position it anywhere on the screen. If the user types R (for right justify)
the label will be
written on the diagram with its right end at the cross-hair position.
If the user types L (for left justify) the label will be written on the
diagram with its left end at the cross hair position.
The
cross-hair will then immediately reappear. The user may put the same
label
on another part of the diagram as before or if he hits the space bar he
will be asked if he wishes to type in another label.
.left margin1
@16. TX 2 @Display a map
.LEFT MARGIN2
.para
It is often convenient to plot a map alongside graphed analysis in order
to
indicate features within the sequence. This function allows users to
draw
maps using files arranged in the form of EMBL feature tables. Of course
the
EMBL table are usually only used for nucleic acid sequence annotation
but,
as long as the features are written in the correct format, they can be
employed by this routine. The map is composed of a line representing the
sequence and then further lines denoting the endpoints of each feature
the
user identifies. The user is asked to define height at which the line
representing the sequence should be drawn; then for the feature height;
then for the features to plot.
.left margin1
@17. TX 1 @Search for strings
.left margin2
.para
Search for strings
perfoms searches of all the sequences for selected words and
shows which sequences they are found in. The user types in a word and
defines the allowed number of mismatches. The results are listed or
plotted. If listed the display includes the sequence number, the position
in the sequence and the matching string.
The results are plotted in the
following way. The x axis of the plot represents the length of the aligned
sequences and the y direction is divided into sufficient strips to accommodate
each sequence. So if a match is found in the 3rd sequence at a position
equivalent to halfway along the longest of the sequences then a short
vertical line will be drawn at the midpoint of the 3rd strip. If the sequences
are aligned it can be useful if the motifs happen to appear in
related positions. For example see the original publication. Typical
dialogue follows.
.lit
? Menu or option number=17
X 1 Plot match positions
2 Plot histogram of matches
? 0,1,2 =
? Word to search for=TTGACA
? Minimum match (0-6) (6) =5
? (y/n) (y) Plot results N
2 35 TAGACA
5 14 TTTACA
6 37 TTTACA
11 14 TAGACA
14 14 TTGACA
17 14 GTGACA
17 22 TTAACA
20 1 TTGACA
.end lit
.left margin1
@18. TX 3 @Set strand
.left margin2
.para
Set strand allows the user to define which strand(s) of the sequences to
analyse: input stand, complement of input, or both.
.left margin1
@19. TX 3 @Set composition
.left margin2
.para
Set composition gives the user three choices for setting the composition
of the sequences for use in the calculation of the information content of
words. The user can select the overall composition of the sequences as read,
an even composition, or can type in any other 4 values.
.left margin1
@20. TX 3 @Set word length
.left margin2
.para
Set word length sets the length of word for which dictionaries will be made.
.left margin1
@21. TX 3 @Set number of mismatches
.left margin2
.para
Set number of mismatches sets the level of fuzziness for the creation of
dictionary Dm.
.left margin1
@22. TX 3 @Show settings
.left margin2
.para
Show settings show the current settings for all parameters associated with
dictionary analysis. A typical diaplsy follows:
.lit
? Menu or option number=22
Current word length = 6
Number of mismatches = 1
Start position = 1
End position = 63
Input strand only
Observed composition
Dictionary Dw unmade
Dictionary Ds unmade
Dictionary Dm unmade
Dictionary Dh unmade
.end lit
.left margin1
@23. TX 3 @Make dictionary Dw
.left margin2
.para
Make dictionary Dw creates a dictionary that contains a count of the
frequency of occurrence of each word in the collected sequences.
.left margin1
@24. TX 3 @Make dictionary Ds
.left margin2
.para
Make dictionary Ds creates a dictionary that contains a count of the
number of different sequences that contain each word.
.left margin1
@25. TX 3 @Make dictionary Dm from Dw
.left margin2
.para
Make dictionary Dm from Dw creates a dictionary from dictionary Dw that
contains the frequency of occurrence of each word (say X) in Dw plus the
frequency of occurrence of each word in Dw that differs from X by up to m
letters. Dm is called a fuzzy dictionary as it contains the frequencies of
occurrence of all words plus the frequencies of all the words that are
similar to them.
.left margin1
@26. TX 3 @Make dictionary Dm from Ds
.left margin2
.para
Make dictionary Dm from Ds creates a dictionary from dictionary Ds that
contains the frequency of occurrence of each word (say X) in Ds plus the
frequency of occurrence of each word in Ds that differs from X by up to m
letters. Dm is called a fuzzy dictionary as it contains the frequencies of
occurrence of all words plus the frequencies of all the words that are
similar to them.
.left margin1
@27. TX 3 @Make dictionary Dh from Dm
.left margin2
.para
Make dictionary Dh creates a dictionary from dictionary Dm and whose
entries are zero except for those words in any set of related words that
are most frequent. It finds the dominant words in each set of relations
and stores their counts.
.left margin1
@28. TX 3 @Examine fuzzy dictionary Dm
.left margin2
.para
Examine dictionary Dm allows users to analyse the contents of dictionary
Dm to find the most common words or those words that contain the most
information. The user supplies a frequency or information cutoff and chooses
to have the results sorted on either value. The program will find the top 100
words that achieve the cutoff values and present them to the user sorted
as selected. The information content will be calcutated from either Dw or Ds
depending which was used to create Dm, and using the current composition
setting. Typical dialogue follows:
.lit
? Menu or option number=28
Looking for highest scoring words
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.62
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 9 Maximum information= 0.7385326
TTGACA 60 0.73850
AAAAAC 64 0.66460
AAAAAA 90 0.64880
GTTTTT 66 0.64300
TTTTTG 73 0.64070
TTTTGT 63 0.63820
TTTTTC 65 0.63810
AAAATA 63 0.62670
TATAAT 65 0.62510
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.62
X 1 Sort on information
2 Sort on word score
? 0,1,2 =2
? Maximum number to list (0-100) (100) =
The words are
Total words= 9 Maximum information= 0.7385326
AAAAAA 90 0.64880
TTTTTG 73 0.64070
GTTTTT 66 0.64300
TTTTTC 65 0.63810
TATAAT 65 0.62510
AAAAAC 64 0.66460
TTTTGT 63 0.63820
AAAATA 63 0.62670
TTGACA 60 0.73850
The highest word score = 115
? Minimum word score (0-115) (0) =!
.end lit
.left margin1
@29. TX 3 @Examine fuzzy dictionary Dh
.left margin2
.para
Examine dictionary Dh allows users to analyse the contents of dictionary Dh
to find the most common words or those words that contain the most
information. The user supplies a frequency or information cutoff and chooses
to have the results sorted on either value. The program will find the top 100
words that achieve the cutoff values and present them to the user sorted as
selected. The information content will be calcutated from either Dw or Ds
depending which was used to create Dh and using the current composition
setting. Typical dialogue follows:
.lit
? Menu or option number=29
Looking for highest scoring words
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.6
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 4 Maximum information= 0.7385326
TTGACA 60 0.73850
AAAAAA 90 0.64880
TATAAT 65 0.62510
TTTTTT 115 0.60630
The highest word score = 115
? Minimum word score (0-115) (0) =50
? Minimum information (0.00-1.00) (0.00) =.5
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 8 Maximum information= 0.7385326
TTGACA 60 0.73850
TCTTGA 54 0.66080
AAAAAA 90 0.64880
TATAAT 65 0.62510
ACTTTA 57 0.61960
TTTTTT 115 0.60630
AGTATA 51 0.60540
TTATAA 55 0.59300
The highest word score = 115
? Minimum word score (0-115) (0) =50
? Minimum information (0.00-1.00) (0.00) =
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 8 Maximum information= 0.7385326
TTGACA 60 0.73850
TCTTGA 54 0.66080
AAAAAA 90 0.64880
TATAAT 65 0.62510
ACTTTA 57 0.61960
TTTTTT 115 0.60630
AGTATA 51 0.60540
TTATAA 55 0.59300
The highest word score = 115
? Minimum word score (0-115) (0) =!
.end lit
.left margin1
@30. TX 3 @Examine words in Dm
.left margin2
.para
Examine words in Dm allows users to analyse the contents of dictonary Dm at the
level of individual words to find their frequency, information content, and to
see their base frequency table. The user types in a word to examine and the
program displays the values and table. The information content will be
calcutated from either Dw or Ds depending which was used to create Dm,
and using the current composition setting. Typical dialogue follows:
.lit
? Menu or option number=30
? Word to examine=TTGACA
TtgacA 60 0.7385326
56 56 6 7 5 11
4 3 2 1 52 1
1 4 2 53 3 48
3 1 54 3 4 4
TTGACA
? Word to examine=TATAAT
taTAat 65 0.6251902
56 3 53 4 4 60
6 1 5 5 5 3
3 60 5 57 57 4
4 5 6 3 3 2
TATAAT
? Word to examine=
.end lit
.left margin1
@31. TX 3 @Examine words in Dh
.left margin2
.para
Examine words in Dh allows users to analyse the contents of dictonary Dh at the
level of individual words to find their frequency, information content, and to
see their base frequency table. The user types in a word to examine and the
program displays the values and table. The information content will be
calcutated from either Dw or Ds depending which was used to create Dm,
and using the current composition setting. Typical dialogue follows:
.lit
? Menu or option number=31
? Word to examine=TTGACA
TtgacA 60 0.7385326
56 56 6 7 5 11
4 3 2 1 52 1
1 4 2 53 3 48
3 1 54 3 4 4
TTGACA
? Word to examine=TATAAT
taTAat 65 0.6251902
56 3 53 4 4 60
6 1 5 5 5 3
3 60 5 57 57 4
4 5 6 3 3 2
TATAAT
? Word to examine=GGGGGG
gggggg 0 0.6199890
3 1 1 2 3 4
1 3 1 2 2 1
2 1 1 1 1 1
11 12 14 12 11 11
GGGGGG
? Word to examine=
.end lit
.left margin1
@32. TX 3 @Save or restore a dictionary
.left margin2
.para
Save or restore dictionary allows users to write or read any dictionary to
and from disk files. The user is asked te define the dictionary and file. The
function is useful if the machine being used is very slow at calculating
because the files can be handled quickly. However note that the files
cannot be processed by any other program.
.left margin1
@33. TX 1 @Find inverted repeats
.left margin2
.para
Find inverted repeats performs searches for simple inverted repeat sequences
in each sequence. They are defined by a range of loop sizes and a minimum
number of potential basepairs. The results can be plotted or listed. The x
axis of the plot represents the length of the aligned sequences and the y
direction is divided into sufficient strips to accommodate each sequence.
So if an inverted repeat is found in the 3rd sequence at a position equivalent
to halfway along the longest of the sequences then a short vertical line will
be drawn at the midpoint of the 3rd strip. Alternatively, if the results are
listed, the potential hairpin loops are drawn out, with the sequence number
and the position of the loop. Typical dialogue follows.
.lit
? Menu or option number=33
Define the range of loop sizes
? Minimum loop size (0-10) (3) =0
? Maximum loop size (1-20) (3) =
? Minimum number of basepairs (1-20) (6) =
? (y/n) (y) Plot results N
Searching
Sequence 3 34
C
G.T
T-A
A-T
T.G
T.G
G.T
ATCTTT TATTTCA
33
Sequence 5 35
T
G.T
T.G
A-T
T.G
G.T
C-G
T.G
TCCGGC AATTGTG
34
.end lit
.left margin1
@ End of help

5116
help/NIP.RNO Normal file
View file

File diff suppressed because it is too large Load diff

88
help/NIPF.RNO Normal file
View file

@ -0,0 +1,88 @@
.NPA
.SP 1
.left margin1
@-1. TX 0 @General
.sp
@-2. TX 0 @Screen control
.sp
@-3. TX 0 @Statistical analysis
.sp
@-1. TX 0 @General
.sp
@-2. TX 0 @Screen control
.sp
@-3. TX 0 @Statistical analysis
.sp
@0. TX -1 @NIPF
.sp
@1. TX 1 @ Help
.sp
@2. TX 1 @ Quit
.sp
@3. TX 1 @ Read new sequence
.sp
@4. TX 1 @ Redefine active region
.sp
@5. TX 1 @ List the sequence
.sp
@6. TX 1 @ List a text file
.sp
@7. TX 1 @ Direct output to disk
.sp
@8. TX 1 @ Write active sequence to disk
.sp
@9. TX 1 @ List a translation
.sp
@32. TX 1 @ List showing base differences
.sp
@37. TX 1 @ List showing translation
.sp
@33. TX 1 @ List showing amino acid differences
.sp
@10. TX 2 @ Clear graphics
.sp
@11. TX 2 @ Clear text
.sp
@12. TX 2 @ Draw a ruler
.sp
@13. TX 2 @ Use cross hair
.sp
@14. TX 2 @ Reset margins
.sp
@15. TX 2 @ Label diagram
.sp
@16. TX 2 @ Display a map
.sp
@17. TX 3 @ Set comparison mode
.sp
@18. TX 3 @ Set sort mode
.sp
@21. TX 3 @ Count base changes
.sp
@22. TX 3 @ Count codon changes
.sp
@23. TX 3 @ Count genetic events
.sp
@24. TX 3 @ Show table of base changes
.sp
@36. TX 3 @ Show table of expressed base changes
.sp
@39. TX 3 @ Show table of silent base changes
.sp
@38. TX 3 @ Estimate mutation rate
.sp
@25. TX 3 @ Plot base changes
.sp
@26. TX 3 @ Plot expressed changes per base
.sp
@27. TX 3 @ Plot silent changes per base
.sp
@28. TX 3 @ Count expressed changes per base
.sp
@29. TX 3 @ Count silent changes per base
.sp
@30. TX 3 @ Count changed amino acids
.sp
@31. TX 3 @ Plot amino acid variability
.sp
@ end of help

2469
help/PIP.RNO Normal file
View file

File diff suppressed because it is too large Load diff

38
help/README Normal file
View file

@ -0,0 +1,38 @@
README file for help directory of staden package
-----------------------------------------------
Should contain (at least) ProgramName_help where ProgramName is each of
bap, dap, gip, mem, mep, nip, nipf, pip, sap, sip and also staden_help
and stadenp_help.
There are 3 main formats of file in this directory:
PROGRAM.RNO:
This is the unformatted (runoff/nroff style) help for PROGRAM.
Any changes to the help should be performed on this file.
program_help:
This is the online formatted help used by PROGRAM. It can also
be printed to produce hardcopy documentation.
program_menu:
This is a file that describes the menus used in PROGRAM,
together with an index into the program_help file for the
online help. The format for each line is:
<option number> <menu number> <program_help offset> <no. of
lines of help> <program type T(ext) or (X)windows> <option name>
Exceptions to these are for the staden_help, stadenp_help, and
splitp_help which do not have the relevant .RNO or _menu files. The
file staden_help gives an introduction to the xterm user interface
(written for vax and vms and so is out of date with the Unix
versions).
See the file splitp_help for information about the reformatting of the
PROSITE motif library.
Rebuild help files with the Unix command "make all". Ensure that the utility
program sethelp is compiled and in the executables search path. The sources
for the program sethelp are found in $STADENROOT/staden.

2523
help/SAP.RNO Normal file
View file

File diff suppressed because it is too large Load diff

1431
help/SIP.RNO Normal file
View file

File diff suppressed because it is too large Load diff

125
help/SPLITP.RNO Normal file
View file

@ -0,0 +1,125 @@
.para
Preparing the PROSITE protein motif library for use by the Staden programs
.para
Introduction
.para
A library of protein motifs (in our terminology, because they include
variable gaps, some would be called patterns) has recently become available
from Amos Bairoch,Departement de Biochimie Medicale,University of Geneva
Currently it contains 317 patterns/motifs and arrives on tape or cdrom
in two files:
a .dat file and a .doc file. There is also a user documentation file
prosite.usr. Here I outline what is required to prepare the PROSITE library for
use by our programs.
.para
Three programs need to be run SPLITP1, SPLITP2, and SPLITP3.
.PARA
Outline of the PROSITE files
.para
A typical entry in the .dat file is shown below.
.lit
ID 2FE2S_FERREDOXIN; PATTERN.
AC PS00197;
DT APR-1990 (CREATED); APR-1990 (DATA UPDATE); APR-1990 (INFO UPDATE).
DE 2Fe-2S ferredoxins, iron-sulfur binding region signature.
PA C-x(1,2)-[STA]-x(2)-C-[STA]-{P}-C.
NR /RELEASE=14,15409;
NR /TOTAL=69(69); /POSITIVE=63(63); /UNKNOWN=0(0); /FALSE_POS=6(6);
NR /FALSE_NEG=5(5);
CC /TAXO-RANGE=A?EP?; /MAX-REPEAT=1;
CC /SITE=1,iron_sulfur; /SITE=5,iron_sulfur; /SITE=8,iron_sulfur;
DR P15788, FER$APHHA , T; P00250, FER$APHSA , T; P00223, FER$ARCLA , T;
DR P00227, FER$BRANA , T; P07838, FER$BRYMA , T; P13106, FER$BUMFI , T;
DR P00247, FER$CHLFR , T; P07839, FER$CHLRE , T; P00222, FER$COLES , T;
DO PDOC00175;
//
.end lit
.para
Each entry has an accession number (here PS00197), a pattern definition
(here C-x(1,2)-[STA]-x(2)-C-[STA]-{P}-C) and a documentation file
cross reference (here PDOC00175).
This pattern means: C, gap of 1 or 2, any of STA, gap of 2, C, any of STA,
not P, C.
.para
We need to convert all of these patterns into our pattern definitions
(as membership of a set, with the appopriate gap ranges) and write each
into a separate pattern file with corresponding "membership of a set"
weight matrices. Each
pattern file is named accession_number.pat (here PS00197.PAT). The
corresponding matrix files are accession_number.wtsa,
accession_number.wtsb, etc for however many are needed (here PS00197.WTSA
and PS00197.WTSB): two are needed because of the variable gap.
.para
In addition we can optionally
split the .dat and .doc files into separate files, one for each
entry, with names accession_number.dat and accession_number.doc. Also we
create an index for the library prosite.lis, which
gives a one line description of each pattern, and ends with the pattern
file and documentation file numbers. The start of the file is shown below.
.lit
N-glycosylation site. 00001,00001
Glycosaminoglycan attachment site. 00002,00002
Tyrosine sulfatation site. 00003,00003
cAMP- and cGMP-dependent protein kinase phosphorylation site. 00004,00004
.end lit
So the name of the pattern file for Glycosaminoglycan attachment site is
PS00002.PAT, and for the documentation file PDOC00002.DOC
.para
Finally we
create a file of file names for all the patterns in the library.
.para
To use the complete PROSITE library from program pip, select "pattern searcher"
and choose the
option "use file of pattern file names", and give the file name
prosite.nam). For any matches found, the accession number and pattern title
will be
displayed.
.para
Running the conversion programs
.para
Only SPLITP3 is necessary for using the library. The others programs
only make the
original files marginally easier to browse through and produce an index.
.para
SPLITP1 splits the prosite.dat file to create a separate file for each
entry. Each file is automatically named PSentry_number.dat. In addition it
creates an index for the library (see above).
.para
SPLITP2 performs the same operation for the Prosite.doc file, except that
no index is created. Files are named PSentry_number.doc.
.para
SPLITP3 creates a separate pattern file and weight matrix files for each
prosite entry from the file prosite.dat. Pattern files are named
PSentry_number.pat, weight matrix files PSentry_number.wtsa,
Psentry_number.wtsb, etc. The pattern title is the one line description
of the motif. SPLITP3 also creates a file of file names. Notice that it
will ask for a path name so that the path can be included in the file of
file names. This is the path to the directory in which the pattern files
are stored.
.para
Notes
.para
Obviously the use of files of file names is a general solution, and anybody
could now create their own set of interesting patterns for screening, or a
subset of prosite.nam, etc.
.para
Note that 5 of the bairoch motifs contained the symbols > or < which
means that the motifs must appear exactly at the N or C termini of the
sequences. Currently our methods have no mechanism for such definitions and,
for example KDEL motifs, will be permitted to occur anywhere throughout
a sequence.
.para
Also, of course, the library does not have to be used solely for performing
mass screenings: each individual entry can be used as a single pattern by
giving the name of its .pat file - eg pathname/ps00002.pat
In addition more sophisticated users will wish to copy pattern files and
weight matrices into their own directories and modify them. For example the
cutoff scores are probably chosen to be quite high in order to reduce the
number of false positives, and some users might wish to lower them.

354
help/STADEN.RNO Normal file
View file

@ -0,0 +1,354 @@
.npa
.left margin2
.para
Introduction to the Staden sequence analysis package and its user interface
.PARA
The package contains the following programs:
.lit
GIP Gel input program
SAP Sequence assemble program
NIP Nucleotide interpretation program
PIP Protein interpretation program
SIP Similarity investigation program
MEP Motif exploration program
NIPL Nucleotide interpretation program (library)
PIPL Protein interpretation program (library)
SIPL Similarity investigation program (library)
.end lit
.left margin2
GIP uses a digitiser for entry of DNA sequences from
autoradiographs.
.left margin2
SAP handles everything relating to assembling gel
readings in order to produce a consensus sequence. It can also deal with
families of protein sequences.
.left margin2
NIP provides functions for analysing and interpretting
individual nucleotide sequences.
.left margin2
PIP provides functions for analysing and interpretting
individual protein sequences.
.left margin2
MEP analyses families of nucleotide sequences to help discover new motifs.
.left margin2
NIPL performs pattern searches on nucleotide sequence libraries.
.left margin2
PIPL performs pattern searches on protein sequence libraries.
.left margin2
SIP provides functions for comparing and aligning
pairs of protein or nucleotide sequences.
.left margin2
SIPL searches nucleotide and protein sequence
libraries for entries similar to probe sequences.
.left margin2
.sk1
.para
Documentation
.para
As is explained below, the
programs SAP, NIP, PIP, SIP and MEP have online help,
and the help files have the names: HELPSAP, HELPNIP, HELPPIP, HELPSIP,
HELPMEP. These
files can be displayed on the screen or printed using the appropriate
commands. Currently the help for the other programs is also contained in
these files. For example help for NIPL is in HELPNIP. This file is called
HELPSTADEN.
.para
Sequence formats
.para
The shotgun sequencing program SAP deals only with simple
text files for gel readings, and is a self-contained system.
However as there is still no single agreed format
for finished sequences or for libraries of sequences,
the other programs in the package can read data that is stored in several ways.
.para
The analytical programs can read individual sequences stored in the following
formats:
Staden, EMBL, Genbank, PIR (also known as NBRF), and GCG, but for storing whole
libraries we use only PIR format. In addition
these programs can perform a number of
simple operations using libraries stored in this format. They can extract
entries by entry name, can search titles for keywords, can search the whole
of the annotation files for keywords, and can extract annotations for any
named entry.
We reformat all sequence libraries into PIR format. Currently we
have NBRF, EMBL, SWISSPROT and VECBASE libraries in PIR format.
.para
The library searching programs operate only
on sequences stored in PIR format.
.para
The analytical programs
will operate with uppercase or lowercase sequence
characters. In addition T and U are equivalent. SAP uses uppercase letters
for original gel readings and lowercase letters for characters that are
corrected by the automatic editor.
Programs NIP and PIP use IUB symbols for redundancy in back translations
and for sequence searches.
The symbols are shown below.
.LIT
NC-IUB SYMBOLS
A,C,G,T
R (A,G) 'puRine'
Y (T,C) 'pYrimidine'
W (A,T) 'Weak'
S (C,G) 'Strong'
M (A,C) 'aMino'
K (G,T) 'Keto'
H (A,T,C) 'not G'
B (G,C,T) 'not A'
V (G,A,C) 'not T'
D (G,A,T) 'not C'
N (G,A,C,T) 'aNy'
.end lit
.PARA
The user interface
.PARA
The user interface is common to all programs.
It consists of a set of menus and a uniform way
of presenting choices and obtaining input
from the user. This section describes: the
menu system; how options are selected and other choices made; how values
are supplied to the program; how help is obtained, and
how to escape from any part of a program. In addition it gives information
about saving results in files and the use of graphics for presenting
results.
.para
Menus
.para
Each program has several menus and numerous options.
Each menu or option has a unique number that is used to
identify it. Menu numbers are distinguished from
option numbers by being preceded by the letter
m (or M, all programs make no distinction between
upper and lower case letters). With the exception of
some parts of program SAP, the menus are not hierachical,
rather the options they each contain are simply lists of
related functions and their identifying numbers.
Therefore options can be selected independently
of the menu that is currently being shown on the
screen, and the menus are simply memory aides.
All options and menus are selected by typing their
option number when the programs present the prompt
.para
"? Menu or option number =".
.para
To select a menu type its number preceded by
the letter M. To select an option type its number.
If you type only "return" you will get menu m0
which is simply a list of menus. If you select an
option you will return to the current menu after the function is completed.
.para
When you select an option, in many cases the
program will immediately perform the operation
selected without further dialogue. If you precede an option
number by the letter d (e.g. D17), you
will force the program to offer dialogue about the selected option
before the function operates,
hence allowing you to change the value of any of its parameters. If
you precede an option number by the symbol ? (e.g. ?17),
you will be given help on the option (here 17).
.para
Where possible, equivalent or identical options have been given the same
numbers in all programs, and so users quickly learn the numbers for
the functions they employ most often.
.para
Help
.para
As mentioned above, help about each option can be obtained by
preceding the option number by the symbol ? when you are presented
with the prompt "? Menu or option number", but there are two further
ways of obtaining help. Whenever the program asks a question
you can respond by typing the symbol ? and you will receive information
about the current option. In addition, option number 1
in all the programs will give help on all of a programs functions.
.para
Quitting
.para
To exit from any point in a program you type ! for quit.
If a menu is on the screen this will stop the program, otherwise
you will be returned to the last menu.
.Para
Other interactions
.para
Questions are presented in a few restricted ways.
In all cases typing only "return" in response to a question means
yes, and typing N or n means no.
.para
Obvious opposites such as "clear screen" and "keep picture"
are presented with only the default shown. For example
in this case the default is generally "keep picture" so the
program will display:
.para
"(y/n) (y) Keep picture"
.para
and the picture will be retained if the user types anything other than N or
n, (in which case the screen will be cleared).
.para
Where there are choices that are not obvious opposites, or
there are more than two choices, two further conventions are used:
"radio buttons" and "check boxes".
.para
Radio buttons are used when only one of a number of choices can be
made at any one time. The choices are presented arranged one above the
other, each choice with a number for its selection, and the default
choice marked with an X. For example in the restriction
enzyme search routine the following choices are offered:
.para
.lit
Select output mode
1 order results enzyme by enzyme
2 order results by positon
X 3 show only infrequent cutters
4 show names above the sequence
? Selection (1-4) (3) =
.end lit
Any single option can be selected by typing the option number,
and the default option, (here shown as 3), is also obtained by
typing only "return". Again help can be obtained by typing ? and
you can quit by typing !.
.para
Check boxes are used when any number of a set of choices can be
made (i.e. the choices are not exclusive). Choices are
made by typing choice numbers. Each choice can be considered
as a switch whose setting is reversed when it is selected. Choices that are
currently switched on are marked with an X.
The user quits from making selections by typing only
"return". For example in the routine that plots base composition
you can plot the frequencies of any combination of bases, e.g. only
A, or A+T, or A+T+G etc.
The following check box is offered to the user:
.lit
X 1 T
2 C
X 3 A
4 G
? Selection (1-4) () =
.END LIT
As shown this will plot the A+T composition. To switch off T
you select 1, to switch on C you select 2, etc, to quit,
having set the bases required you type only "return".
.para
Input of numerical values
.para
All input of integer or decimal numbers is presented in a
standard way with the allowed range shown in brackets and the default
value also in brackets. For example:
.para
? span (5-31) (11) =
.para
In this example you could type any number between 5 and 31,
or "return" only, or ! or ? (see above). Any other input will cause the
program to ask the question again. Typing only "return" gives the default
value (here 11).
.para
Use of the bell
.para
The programs use the bell to indicate that a task is completed.
This allows users to read textual results before they are scrolled up off
the screen, or to look at a plot before it is scrolled over by the menus.
When the bell sounds, the programs will wait
until return is typed. You can quit from these points by typing ! but
no help is available.
.para
Printing and saving results in files
.para
A few of the functions in the programs automatically write their textual
results
to disk files, but for most functions you can choose whether results
appear on the terminal screen or go to a file. This applies to both text
and graphical results.
For these functions
the normal, or default, place for results to
appear is on the screen, and users need to decide before the
function is selected if they want to redirect the results to a file.
In all programs, option number 7, "Direct output to disk" gives control
over whether results appear on the screen or go to a file. When a program
is started results will be sent to the screen. If option 7 is selected
users will be given the choice of redirecting either text or graphics to a
file. The program will then ask users to supply a file name. From that
point on all results will be sent to the file until option 7 is selected again,
in which case the "redirection file" will be closed, and results will start
to appear on the screen.
.para
If these files contain textual results they can be looked at
from within the programs
by using option 6, "List a text file". Once you leave the program
you can use an appropriate system command to print the files.
There is no function within the programs to direct files to a printer.
.para
The converse of the above is also possible. That
is, it is possible to redirect results that would normally go to file,
so that they appear instead on the screen. This is often useful as a way
of checking results before saving them in a file. On a VAX using
VMS you do this by typing TT: for the name of the file that the
program would create. TT: is what VMS calls the screen.
.para
Use of graphics
.para
The analytical programs including NIP, PIP and SIP present the results of
many of their analyses graphically. The position at which the results for
any function appear on the screen is defined relative to a notional users
"drawing board" of dimension 10,000 by 10,000. This drawing board fills the
screen and results are drawn in windows defined using symbols x0,yo and
xlength,ylength,
where x0,y0 is the position of the bottom left hand corner of the window,
and xlength is the width of the window and ylength the
height of the window.
.lit
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
.end lit
.para
The window positions for each option are read from a file
when a program is started. If required individual users could have their
own set of plot positions, and also the positions
can be redefined from within the
programs using option number 14.
.para
For those analyses that draw continuous lines to represent results
(for example a plot of base composition) the user is asked to supply the
"Plot interval". All the analyses produce a value for every point along the
sequence but often it is unnecessary to actually plot the
values for all the points.
The plot interval is simply the distance between the points
shown on the screen. If the user selects a plot interval of 1, every point
will be plotted; a plot interval of 3 will show every third point. It is a
way of speeding up the analyses.
.para
Saving graphics
.para
Many terminals are not capable of dumping their screen contents to a
file for subsequent printing. One convenient way of obtaining hard copy
of graphical results is to use a micro computer as a terminal. On
the Macintosh we use the terminal emulator versa
termPro. This allows graphics to be saved as
Macintosh files that can be annotated and printed using
Macdraw and other painting programs.
.para
Alternatively graphics can be redirected to a file and printed using a
laser printer with tektronix capability (see
"Printing and saving results in files").

2112
help/bap_help Normal file
View file

File diff suppressed because it is too large Load diff

84
help/bap_menu Normal file
View file

@ -0,0 +1,84 @@
-1 0 21 2 T General
-1 0 21 2 X General
-2 0 50 2 T Screen control
-2 0 71 2 X Screen
-3 0 98 2 T Modification
-3 0 98 2 X Modification
0 -1 116 332 T BAP
0 -1 116 332 X BAP
17 1 17434 18 T Screen against enzymes
17 1 17434 18 X Screen against enzymes
18 1 18477 23 T Screen against vector
18 1 18477 23 X Screen against vector
20 3 19859 121 T Auto assemble
20 3 19859 121 X Auto assemble
28 1 26426 43 T Highlight disagreements
28 1 26426 43 X Highlight disagreements
32 3 28846 17 T Extract gel readings
32 3 28846 17 X Extract gel readings
1 0 29607 3 T Help
1 0 29607 3 X Help
2 0 29676 5 T Quit
2 0 29676 5 X Quit
3 1 29869 230 T Open a database
3 1 29869 230 X Open a database
4 3 41499 320 T Edit contig
4 3 41499 320 X Edit contig
5 1 56688 43 T Display a contig
5 1 56688 43 X Display a contig
6 1 58990 6 T List a text file
6 1 58990 6 X List a text file
8 1 59248 93 T Calculate a consensus
8 1 59248 93 X Calculate a consensus
25 1 63707 41 T Show relationships
25 1 63707 41 X Show relationships
23 3 65650 11 T Complement a contig
23 3 65650 11 X Complement a contig
22 3 66173 59 T Join contigs
22 3 66173 59 X Join contigs
24 1 69194 11 T Copy the database
24 1 69194 11 X Copy the database
19 1 69740 43 T Check database
19 1 69740 43 X Check database
29 1 71898 82 T Examine quality
29 1 71898 82 X Examine quality
26 3 75715 84 T Alter relationships
26 3 75715 84 X Alter relationships
27 1 79641 17 T Set display parameters
27 1 79641 17 X Set display parameters
30 3 80503 7 T Shuffle pads
30 3 80503 7 X Shuffle pads
10 2 80866 3 T Clear graphics
10 2 80866 3 X Clear graphics
11 2 80931 3 T Clear text
11 2 80931 3 X Clear text
12 2 80996 12 T Draw a ruler.
12 2 80996 12 X Draw a ruler.
14 2 81730 38 T Reposition plots
14 2 81730 38 X Reposition plots
15 2 84069 28 T Label a diagram
15 2 84069 28 X Label a diagram
16 2 85174 3 T Display a map
16 2 85174 3 X Display a map
7 1 85228 12 T Redirect output
7 1 85228 12 X Redirect output
13 2 85731 43 T Use crosshair
13 2 85731 43 X Use crosshair
33 2 87876 12 T Plot single contig
33 2 87876 12 X Plot single contig
34 2 88578 10 T Plot all contigs
34 2 88578 10 X Plot all contigs
31 3 89160 21 T Disassemble readings
31 3 89160 21 X Disassemble readings
35 3 90372 94 T Find internal joins
35 1 90372 94 T Find internal joins
35 3 90372 94 X Find internal joins
35 1 90372 94 X Find internal joins
36 3 96201 30 T Double strand
36 3 96201 30 X Double strand
37 3 97555 64 T Auto-select oligos
37 3 97555 64 X Auto-select oligos
38 1 100421 30 T Check assembly
38 1 100421 30 X Check assembly
39 1 102178 90 T Find read pairs
39 1 102178 90 X Find read pairs

2112
help/dap_help Normal file
View file

File diff suppressed because it is too large Load diff

79
help/dap_menu Normal file
View file

@ -0,0 +1,79 @@
-1 0 21 2 T General
-1 0 21 2 X General
-2 0 50 2 T Screen control
-2 0 71 2 X Screen
-3 0 98 2 T Modification
-3 0 98 2 X Modification
0 -1 116 351 T SAP
0 -1 116 351 X SAP
17 1 18801 18 T Screen against enzymes
17 1 18801 18 X Screen against enzymes
18 1 19844 22 T Screen against vector
18 1 19844 22 X Screen against vector
20 3 21171 113 T Auto assemble
20 3 21171 113 X Auto assemble
28 1 27332 42 T Highlight disagreements
28 1 27332 42 X Highlight disagreements
32 3 29694 22 T Extract gel readings
32 3 29694 22 X Extract gel readings
1 0 30797 3 T Help
1 0 30797 3 X Help
2 0 30866 5 T Quit
2 0 30866 5 X Quit
3 1 31059 237 T Open a database
3 1 31059 237 X Open a database
4 3 43258 239 T Edit contig
4 3 43258 239 X Edit contig
9 3 54180 42 T Screen edit
5 1 56376 45 T Display a contig
5 1 56376 45 X Display a contig
6 1 58862 6 T List a text file
6 1 58862 6 X List a text file
8 1 59120 93 T Calculate a consensus
8 1 59120 93 X Calculate a consensus
25 1 63651 41 T Show relationships
25 1 63651 41 X Show relationships
21 3 65587 101 T Enter new gel reading
21 3 65587 101 X Enter new gel reading
23 3 70677 11 T Complement a contig
23 3 70677 11 X Complement a contig
22 3 71200 63 T Join contigs
22 3 71200 63 X Join contigs
24 1 74467 11 T Copy the database
24 1 74467 11 X Copy the database
19 1 75013 41 T Check database
19 1 75013 41 X Check database
29 1 77032 82 T Examine quality
29 1 77032 82 X Examine quality
26 3 80849 101 T Alter relationships
26 3 80849 101 X Alter relationships
27 1 86065 17 T Set display parameters
27 1 86065 17 X Set display parameters
30 3 86933 48 T Auto edit a contig
30 3 86933 48 X Auto edit a contig
10 2 89409 3 T Clear graphics
10 2 89409 3 X Clear graphics
11 2 89474 3 T Clear text
11 2 89474 3 X Clear text
12 2 89539 12 T Draw a ruler.
12 2 89539 12 X Draw a ruler.
14 2 90273 38 T Reposition plots
14 2 90273 38 X Reposition plots
15 2 92612 28 T Label a diagram
15 2 92612 28 X Label a diagram
16 2 93717 27 T Display a map
16 2 93717 27 X Display a map
7 1 94692 12 T Redirect output
7 1 94692 12 X Redirect output
13 2 95163 43 T Use crosshair
13 2 95163 43 X Use crosshair
33 2 97308 12 T Plot single contig
33 2 97308 12 X Plot single contig
34 2 98010 10 T Plot all contigs
34 2 98010 10 X Plot all contigs
31 3 98592 12 T Type in gel readings
31 3 98592 12 X Type in gel readings
35 3 99223 92 T Find internal joins
35 1 99223 92 T Find internal joins
35 3 99223 92 X Find internal joins
35 1 99223 92 X Find internal joins

198
help/gip_help Normal file
View file

@ -0,0 +1,198 @@
GIP
A digitizer is a two dimensional surface which is such that
if a special pen is pressed onto it, the pens coordinates can be
recorded by a computer. These coordinates can be interpreted by a
program.
The digitizing device we use works by the pen emitting a high
frequency sound which is picked up by two microphones positioned at
the rear of the working area. The pen position is determined by
triangulation and the digitizing device sends the coordinates to the
computer. As no special surface is required the device can
conveniently be positioned on a light box giving the sequencer an
unobscured view of the autoradiographs.
The digitizer is called a GRAPHBAR MODEL GP7 made by Science
Accessories Corp, 970 Kings Highway West, Southport, Connecticut
06490, USA.
The program uses a menu to allow the user to select commands
or to enter the uncertainty codes for areas of the gel that
are difficult to interpret. A menu is simply a series of boxes drawn
on the digitizing surface that each contain a command or
uncertainty code. When the user puts the pen down in these special
regions the program interprets the coordinates as commands and acts
appropriately. A copy of the menu should have been sent to you. It
should be stuck down on the surface of the light box in the
digitizing area. For convenience it is best to position it to the
right of the digitizing area, but in practice as long as its top edge
is parallel to the digitizer box, it can be put anywhere in the
active region.
Entering gel readings using a digitizer
The autoradiograph should be stuck down on the light box with
the lanes running, as near is as possible, at right angles to the
digitizer. To read an autoradiograph placed on the light box the user
need only define the positions of the four sequencing lanes and the
bases to which they correspond and then use the pen to point to
each successive band progressing up the gel. The program examines
the coordinates of each pen position to see in which of the four
lanes it lies and assigns the corresponding base to be stored
in the computer. Each time the pen tip is depressed to point to a
position on the surface of the digitizer the program sounds the
bell on the terminal (a different sound for each of the four bases on
the microcomputer version of the program) to indicate to the user
that a point has been recorded. As the sequence is read the
program displays it on the screen.
The program uses a menu to allow the user to select commands
or to enter the uncertainty codes for areas of the gel that
are difficult to interpret. A menu is simply a series of boxes drawn
on the digitizing surface that each contain a command or
uncertainty code. When the user puts the pen down in these special
regions the program interprets the coordinates as commands and acts
appropriately. As well as the uncertainty codes
A,C,G,T,1,2,3,4,B,D,H,V,R,Y,X,-,5,6,7,8 the following commands are
included in the menu: DELETE removes the last character from the
sequence; RESET allows the lane centres to be redefined; START means
begin the next stage of the procedure; STOP means stop the
current stage in the procedure; CONFIRM means confirm that the last
command or set of coordinates are correct.
The digitizing device also has a menu of its own. This lies in
a two inch wide strip immediately in front of the digitizing box. Pen
positions within this two inch strip are interpretted as commands to
the digitizer and are not sent to the GIP program. In general the
only time users will need to use the device menu is when they tell
GIP where the program menu lies in the digitizing area. This is done
by first hitting ORIGIN in the device menu and then hitting the
bottom left hand corner of the program menu. The program menu can
hence be positioned anywhere in the active region but should be
arranged parallel to the digitizer.
The user should try to hit the bands as near as possible to
the centre of the lanes because the program tracks the lanes up the
film using the pen positions. By using this tracking strategy the
user only has to define the centres of the bottom of the lanes before
starting to read the film. The program can correctly follow quite
curved lanes and constantly checks that its lane centre coordinates
look sensible. If the lane centres appear to be getting too close the
program stops responding to the pen positions of bands and hence does
not ring the bell. If this occurs users must hit the reset box in the
menu and the program will request them to redefine the lane centres
at the current reading position. Then they can continue reading. As a
further safeguard the program will only respond to pen positions
either in the menu or very close to the current reading position.
Running the gel reading program
The autoradiograph should be firmly stuck down on the light box and
the program started by typing GIP. It will ask the first question.
" ? FILE OF FILE NAMES="
Type the name for the file of file names and then follow the
instructions.
" HIT DIGITIZER MENU ORIGIN"
" THEN PROGRAM MENU ORIGIN"
" THEN HIT START IN PROGRAM MENU"
If the bell does not sound after you hit start try hitting metric in
the device menu (the program uses metric units, and some digitizers
are set to default to use inches; hitting metric switches between
the two).
After the bell has sounded the program will give the default lane
order.
" LANE ORDER IS T C A G"
" IF CORRECT HIT CONFIRM, ELSE HIT RESET"
If the lane order, reading from left to right is correct hit confirm
in the program menu. If you are using a different order hit reset
and you will be asked to define the lane order from left to right
using the program menu (as follows).
" DEFINE LANE ORDER (LEFT TO RIGHT) USING MENU"
Hit the boxes in the menu that contain the symbols A,C,G,T in the
left-right order of the lanes. The program will respond with the
lane order as above and ask for confirmation. When this is received,
the next task is to define the start positions of the next four
lanes.
" HIT START, THEN HIT (LEFT TO RIGHT)"
" THE START POSITIONS FOR THE NEXT FOUR LANES"
Hit the centres of the four lanes at a height level with the first
band that is going to be read. The program will report the mean lane
separations and asks for confirmation that they are correct.
" MEAN LANE SEPARATION IS XX"
" HIT CONFIRM TO CONTINUE"
Users will become familiar with the values from their films and will
spot any unusual numbers. Asking for confirmation allows users to
try again if they had made a mistake, but generally the lane
separation values can be ignored. Hit confirm, and the program will
give the message
" HIT START WHEN READY TO BEGIN READING"
Hit start and the program will give the message
" HIT BANDS, UNCERTAINTY CODES, RESET OR STOP"
Hit the bands, interpretting the sequence progressing up the film.
If necessary use the uncertainty codes. If the pen stops responding
hit reset and follow the instructions as above. When the sequence
becomes unreadable hit stop and the program will ask for a file name
for the gel reading just read.
" ? FILE NAME FOR THIS GEL READING="
Type the file name observing the rules about legal gel readings
names. The program will ask if you wish to read another sequence.
" TO ENTER ANOTHER GEL READING TYPE 1"
To enter another type 1 and you will be back to the step of defining
the lane order. Typing anything else will stop the program.
Running the microcomputer version of the gel reading program
The microcomputer version of GIP is slightly different and is called
GIPB. The BBC micro does not have the capacity to process the gel
readings beyond the reading stage. This means that users of this
program would need to transfer their gel readings from the micro to
another machine using a terminal emmulator. Transferring many files
is tedious and so the microcomputer version of the gel reading
program stores all the gel readings for each run of the program in a
single file. This special file contains both sequences and file names
and can be moved in a single transfer to another machine. Once on the
other machine the single file must be split into separate gel reading
files and a file of file names. This is done using the program
BSPLIT. As far as using the microcomputer version of GIP, the only
difference is that the first file name the program requests is not a
file of file names, but a name for the single file to contain all the
gel readings and their names.

0
help/gip_menu Normal file
View file

48
help/makefile Normal file
View file

@ -0,0 +1,48 @@
#
# Make file for help files - this requires gmake on some systems.
#
PROGS = bap dap gip mep nip \
nipf pip sap sip #mem
HELPS = bap_help dap_help gip_help mep_help nip_help \
nipf_help pip_help sap_help sip_help #mem_help
MENUS = bap_menu dap_menu gip_menu mep_menu nip_menu \
nipf_menu pip_menu sap_menu sip_menu #mem_menu
all: $(PROGS)
DOIT = rm -f $@_help $@_menu; ./runoff $?
bap: BAP.RNO
$(DOIT)
dap: DAP.RNO
$(DOIT)
gip: GIP.RNO
$(DOIT)
#mem: MEM.RNO
# $(DOIT)
mep: MEP.RNO
$(DOIT)
nip: NIP.RNO
$(DOIT)
nipf: NIPF.RNO
$(DOIT)
pip: PIP.RNO
$(DOIT)
sap: SAP.RNO
$(DOIT)
sip: SIP.RNO
$(DOIT)
clean:
rm -f $(HELPS) $(MENUS)

698
help/mem_help Normal file
View file

@ -0,0 +1,698 @@
@0. B 1 @MEP
This is a program for analysing families of nucleotide sequences in
order to find common motifs and potential binding sites. The ideas
in this program were described in Staden, R. "Methods for
discovering novel motifs in nucleic acid sequences". Computer
Applications in the Biosciences, 5, 293-298, (1989).
The program can read sequences stored in either of two
formats: 1) all sequences aligned in a single file; 2) all sequences
in separate files and accessed through a file of file names.
The program contains functions that can answer several
questions about a set of sequences:
Which words are most common?
Which words occur in the most sequences?
Which words contain the most information?
Which words occur in equivalent positions in the sequences?
Which words are inverted repeats?
Which words occur on both strands of the sequences?
Where are the inverted repeats?
Where are the fuzzy words?
Most of the program is concerned with analysing what it terms
"fuzzy words" within the set of sequences. The analysis is explained
below. Note that the standard version of the programs is limited to
words of maximum length 8 letters, and a maximum fuzziness of 2.
The following analyses (preceded by their option numbers) are
included:
? = Help
! = Quit
3 = Read new sequences
4 = Redefine active region
5 = List the sequences
6 = List text file
7 = Direct output to disk
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Reset margins
15 = Label diagram
16 = Draw map
17 = Search for strings
18 = Set strand
19 = Set composition
20 = Set word length
21 = Set number of mismatches
22 = Show settings
23 = Make dictionary Dw
24 = Make dictionary Ds
25 = Make fuzzy dictionary Dm from Dw
26 = Make fuzzy dictionary Dm from Ds
27 = Make fuzzy dictionary Dh from Dm
28 = Examine fuzzy dictionary Dm
29 = Examine fuzzy dictionary Dh
30 = Examine words in Dm
31 = Examine words in Dh
32 = Save or restore a dictionary
33 = Find inverted repeats
Some of these methods produce graphical results and so the
program is generally used from a graphics terminal (a vdu on which
lines and points can be drawn as well as characters).
The positions of each of the plots is defined relative to a users
drawing board which has size 1-10,000 in x and 1-10,000 in y. Plots
for each option are drawn in a window defined by x0,y0 and
xlength,ylength. Where x0,y0 is the position of the bottom left hand
corner of the window, and xlength is the width of the window and
ylength the height of the window.
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "MEPMARG" when the
program is started. Users can have their own file if required.
The options for the program are accessed from 3 main menus:
general, screen control and dictionary analylsis. Both menus and
options are selected by number.
The most important and novel part of the program is its use of
"fuzzy dictionaries" and an information theory measure, to help show
the most interesting motifs. Central to the method is the idea of a
fuzzy dictionary of word frequencies. A dictionary of word
frequencies is an ordered list of all the words in the sequences and
a count of the number of times that they occur. A fuzzy dictionary
is an equivalent list but which contains instead, for each word, a
count of the number of times similar words occur in the sequences.
We term words that are similar "relations". The fuzziness is defined
by the number of letters in a word that are allowed to be different.
So if we had a fuzziness of 1 we allow 1 letter to be different. For
example, with a fuzziness of 1, the entry in the fuzzy dictionary
for the word TTTTTT would contain a count of the numbers of times
TTTTTT occured plus the number of times all words differing by
exactly one letter from TTTTTT occured.
Once the fuzzy dictionary has been created we can examine it
in several ways to find candidate control sequences. The simplest
question we can ask is which word in the dictionary is the most
common. Sometimes this simple criterion of "most common" may be
adequate to discover a new motif but in general we would not expect
it to be sufficient. For example some words will be common simply
because of a base composition bias in the sequences being analysed.
In addition a word can be the most frequent and yet not be "well
defined". This last point is best explained by an example.
Suppose we were looking at two letter words and allowing one
mismatch, and that there were 10 occurences of TT and 5 of AC. We
could align the 10 words that were one letter different from TT and
the 5 that were related to AC. Then we could count the number of
times each base occured in each position for each of these two sets
of words. Suppose we got the two base frequency tables shown below.
TT AC
T 6 4 T 1 0
C 1 3 C 0 4
A 1 2 A 4 1
G 2 1 G 0 0
These tables show that although TT occurs (with one letter mismatch)
more often than AC, the ratio of base frequencies for AC at 4/5, 4/5
is higher than those for TT at 6/10, 4/10. Hence we would say that
AC was better defined than TT. Expressing this another way we would
say that the definition of AC contained more information than that
for TT. The program calculates the information content in a way that
takes into account both the sequence composition and the level of
definition of the motif.
Definitions
Here we deal only with the dictionary analysis. Suppose we
are dealing with a set of sequences and are examining them for words
that are six characters in length.
Dictionary Dw contains a count of the number of times each
word occurs in the set of sequences. For example the entry for
TTTTTT contains a value equal to the number of times the word TTTTTT
occurs in the set of sequences.
Dictionary Ds contains a count of the number of different
sequences in which each word occurs. For example if the entry for
word TTTTTT contains the value 10, it denotes that the word TTTTTT
occurs in ten different sequences. Unlike Dw it only counts words
once for each sequence. For example if we had a set of 100
sequences, the maximum possible value that Ds could take is 100, and
this would only happen if a word occurred in every sequence. However
for the same set of sequences, Dw could contain values greater than
100, and this would show that a word had occurred more than once in
at least one sequence.
From either of the two dictionaries Dw or Ds we can calculate
a fuzzy dictionary Dm. For each word, the entry in the fuzzy
dictionary Dm contains the sum of the dictionary values (taken from
either Dw or Ds) for all words that differ from it by up to m
letters. For example if m=2 the entry for TTTTTT contains the number
of times that TTTTTT occurs in the dictionary, plus the counts for
all words that differ from TTTTTT by 1 or 2 letters. Obviously the
interpretation of the values in Dm depends on which of the two
dictionaries Dw or Ds they were derived from. When derived from Dw
the entry for any word in Dm gives the total number of times it, and
its relations, occur in the set of sequences. When derived from Ds
the entry for any word in Dm gives the total number of different
sequences that contain a word and each of its relations.
Finally, from fuzzy dictionary Dm we can derive fuzzy
dictionary Dh. All entries in Dh are zero except for the word(s),
within each set of relations, that are most frequent. For example if
TTTTTT occurred 20 times but had a relation that occurred more
often, then the entry for TTTTTT would be zero. However if TTTTTT
did not have a more frequently occurring relation, then the entry
for TTTTTT would contain the value 20.
@1. B 1 @Help
This option gives online help. The user should select option numbers
and the current documentation will be given. Note that option 0
gives an introduction to the program, and that ? will get help from
anywhere in the program. The following analyses (preceded by their
option numbers) are included:
? = Help
! = Quit
3 = Read new sequences
4 = Redefine active region
5 = List the sequences
6 = List text file
7 = Direct output to disk
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Reset margins
15 = Label diagram
16 = Draw map
17 = Search for strings
18 = Set strand
19 = Set composition
20 = Set word length
21 = Set number of mismatches
22 = Show settings
23 = Make dictionary Dw
24 = Make dictionary Ds
25 = Make fuzzy dictionary Dm from Dw
26 = Make fuzzy dictionary Dm from Ds
27 = Make fuzzy dictionary Dh from Dm
28 = Examine fuzzy dictionary Dm
29 = Examine fuzzy dictionary Dh
30 = Examine words in Dm
31 = Examine words in Dh
32 = Save or restore a dictionary
33 = Find inverted repeats
@2. B 1 @Quit
This function stops the program.
@3. B 1 @Read a new sequence.
It can read sequences stored in either of two formats: 1) all
sequences aligned in a single file; 2) all sequences in separate
files and accessed through a file of file names. Typical dialogue
follows:
X 1 Read file of aligned sequences
2 Use file of file names
? 0,1,2 =
? File of aligned sequences=F1
Number of files 88
@4. B 1 @Define active region
For its analytic functions the program always works on a region of
the sequence called the active region. When new sequences are read
into the program the active region is automatically set to start at
the beginning of the sequences and go up to the end of the longest
one.
@5. B 1 @List a sequence.
The sequence can be listed with line lengths of 50 bases with each
sequence numbered in the order in which they were read. Output can
be directed to a disk file by first selecting disk output. Typical
dialogue follows.
? Menu or option number=5
10 20 30 40 50
1 TAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCA
2 CAAATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTAC
3 TAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTATT
4 ACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTA
5 AGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
6 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGC
7 ACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCG
8 GGGGCAAGGAGGATGGAAAGAGGTTGCCGTATAAAGAAACTAGAGTCCGT
9 AGGGGGTGGAGGATTTAAGCCATCTCCTGATGACGCATAGTCAGCCCATC
10 AAAACGTCATCGCTTGCATTAGAAAGGTTTCTGGCCGACCTTATAACCAT
60
1 TACCCGTTTTT
2 GCGTTTTTGT
3 TCATACCATAAG
4 TTTCATACC
5 ATTGTGAGC
6 TTCCGGCTCG
7 GAAGAGAGT
8 TCAGGTGT
9 ATGAATG
10 TAATTACG
@6. B 1 @List a text file.
Allows the user to have a text file displayed on the screen. It will
appear one page at a time.
@7. B 1 @Direct output to disk
Used to direct output that would normally appear on the screen
to a file.
Select redirection of either text or graphics, and supply the
name of the file that the output should be written to.
The results from the next options selected will not appear on
the screen but will be written to the file. When option 7 is
selected again the file will be closed and output will again appear
on the screen.
@10. B 1 @Clear graphics
Clears the screen of both text and graphics.
@11. B 1 @Clear text
Clears only text from the screen.
@12. B 1 @Draw a ruler.
This option allows the user to draw a ruler or scale along the x
axis of the screen to help identify the coordinates of points of
interest. The user can define the position of the first amino acid
to be marked (for example if the active region is 1501 to 8000, the
user might wish to mark every 1000th amino acid starting at either
1501 or 2000 - it depends if the user wishes to treat the active
region as an independent unit with its own numbering starting at its
left edge, or as part of the whole sequence). The user can also
define the separation of the ticks on the scale and their height. If
required the labelling routine can be used to add numbers to the
ticks.
@13. B 1 @Use crosshair.
This function puts a steerable cross on the screen that can be used
to find the coordinates of points in the sequence. The user can move
the cross around using the directional keys; when he hits the space
bar the program will print out the coordinates of the cross in
sequence units and the option will be exited.
If instead, you hit a , the position will be displayed but the
cross will remain on the screen.
If a letter s is hit the sequence around the cross hair is
displayed and the cross remains on the screen.
@14. B 1 @Reposition plots
The positions of each of the plots is defined relative to a users
drawing board which has size 1-10,000 in x and 1-10,000 in y. Plots
for each option are drawn in a window defined by x0,y0 and
xlength,ylength. Where x0,y0 is the position of the bottom left hand
corner of the window, and xlength is the width of the window and
ylength the height of the window.
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "MEPMARG" when the
program is started. Users can have their own file if required. As
all the plots start at the same position in x and have the same
width, x0 and xlength are the same for all options. Generally users
will only want to change the start level of the window y0 and its
height ylength. This option allows users to change window positions
whilst running the program. The routine prompts first for the
number of the option that the users wishes to reposition; then for
the y start and height; then for the x start and length. Note that
changes to the x values affect all options. If the user types only
carriage return for any value it will remain unchanged. The cross-
hair can be used to choose suitable heights.
@15. B 1 @Label a diagram
This routine allows users to label any diagrams they have produced.
They are asked to type in a label. When the user types carriage
return to finish typing the label the cross-hair appears on the
screen. The user can position it anywhere on the screen. If the user
types R (for right justify) the label will be written on the diagram
with its right end at the cross-hair position. If the user types L
(for left justify) the label will be written on the diagram with its
left end at the cross hair position. The cross-hair will then
immediately reappear. The user may put the same label on another
part of the diagram as before or if he hits the space bar he will be
asked if he wishes to type in another label.
@16. B 1 @Display a map.
It is often convenient to plot a map alongside graphed analysis in
order to indicate features within the sequence. This function allows
users to draw maps using files arranged in the form of EMBL feature
tables. Of course the EMBL table are usually only used for nucleic
acid sequence annotation but, as long as the features are written in
the correct format, they can be employed by this routine. The map is
composed of a line representing the sequence and then further lines
denoting the endpoints of each feature the user identifies. The user
is asked to define height at which the line representing the
sequence should be drawn; then for the feature height; then for the
features to plot.
@17. B 1 @Search for strings
Search for strings perfoms searches of all the sequences for
selected words and shows which sequences they are found in. The user
types in a word and defines the allowed number of mismatches. The
results are listed or plotted. If listed the display includes the
sequence number, the position in the sequence and the matching
string. The results are plotted in the following way. The x axis of
the plot represents the length of the aligned sequences and the y
direction is divided into sufficient strips to accommodate each
sequence. So if a match is found in the 3rd sequence at a position
equivalent to halfway along the longest of the sequences then a
short vertical line will be drawn at the midpoint of the 3rd strip.
If the sequences are aligned it can be useful if the motifs happen
to appear in related positions. For example see the original
publication. Typical dialogue follows.
? Menu or option number=17
X 1 Plot match positions
2 Plot histogram of matches
? 0,1,2 =
? Word to search for=TTGACA
? Minimum match (0-6) (6) =5
? (y/n) (y) Plot results N
2 35 TAGACA
5 14 TTTACA
6 37 TTTACA
11 14 TAGACA
14 14 TTGACA
17 14 GTGACA
17 22 TTAACA
20 1 TTGACA
@18. B 1 @Set strand
Set strand allows the user to define which strand(s) of the
sequences to analyse: input stand, complement of input, or both.
@19. B 1 @Set composition
Set composition gives the user three choices for setting the
composition of the sequences for use in the calculation of the
information content of words. The user can select the overall
composition of the sequences as read, an even composition, or can
type in any other 4 values.
@20. B 1 @Set word length
Set word length sets the length of word for which dictionaries will
be made.
@21. B 1 @Set number of mismatches
Set number of mismatches sets the level of fuzziness for the
creation of dictionary Dm.
@22. B 1 @Show settings
Show settings show the current settings for all parameters
associated with dictionary analysis. A typical diaplsy follows:
? Menu or option number=22
Current word length = 6
Number of mismatches = 1
Start position = 1
End position = 63
Input strand only
Observed composition
Dictionary Dw unmade
Dictionary Ds unmade
Dictionary Dm unmade
Dictionary Dh unmade
@23. B 1 @Make dictionary Dw
Make dictionary Dw creates a dictionary that contains a count of
the frequency of occurrence of each word in the collected sequences.
@24. B 1 @Make dictionary Ds
Make dictionary Ds creates a dictionary that contains a count of the
number of different sequences that contain each word.
@25. B 1 @Make dictionary Dm from Dw
Make dictionary Dm from Dw creates a dictionary from dictionary Dw
that contains the frequency of occurrence of each word (say X) in Dw
plus the frequency of occurrence of each word in Dw that differs
from X by up to m letters. Dm is called a fuzzy dictionary as it
contains the frequencies of occurrence of all words plus the
frequencies of all the words that are similar to them.
@26. B 1 @Make dictionary Dm from Ds
Make dictionary Dm from Ds creates a dictionary from dictionary Ds
that contains the frequency of occurrence of each word (say X) in Ds
plus the frequency of occurrence of each word in Ds that differs
from X by up to m letters. Dm is called a fuzzy dictionary as it
contains the frequencies of occurrence of all words plus the
frequencies of all the words that are similar to them.
@27. B 1 @Make dictionary Dh from Dm
Make dictionary Dh creates a dictionary from dictionary Dm and
whose entries are zero except for those words in any set of related
words that are most frequent. It finds the dominant words in each
set of relations and stores their counts.
@28. B 1 @Examine dictionary Dm
Examine dictionary Dm allows users to analyse the contents of
dictionary Dm to find the most common words or those words that
contain the most information. The user supplies a frequency or
information cutoff and chooses to have the results sorted on either
value. The program will find the top 100 words that achieve the
cutoff values and present them to the user sorted as selected. The
information content will be calcutated from either Dw or Ds
depending which was used to create Dm, and using the current
composition setting. Typical dialogue follows:
? Menu or option number=28
Looking for highest scoring words
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.62
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 9 Maximum information= 0.7385326
TTGACA 60 0.73850
AAAAAC 64 0.66460
AAAAAA 90 0.64880
GTTTTT 66 0.64300
TTTTTG 73 0.64070
TTTTGT 63 0.63820
TTTTTC 65 0.63810
AAAATA 63 0.62670
TATAAT 65 0.62510
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.62
X 1 Sort on information
2 Sort on word score
? 0,1,2 =2
? Maximum number to list (0-100) (100) =
The words are
Total words= 9 Maximum information= 0.7385326
AAAAAA 90 0.64880
TTTTTG 73 0.64070
GTTTTT 66 0.64300
TTTTTC 65 0.63810
TATAAT 65 0.62510
AAAAAC 64 0.66460
TTTTGT 63 0.63820
AAAATA 63 0.62670
TTGACA 60 0.73850
The highest word score = 115
? Minimum word score (0-115) (0) =!
@29. B 1 @Examine dictionary Dh
Examine dictionary Dh allows users to analyse the contents of
dictionary Dh to find the most common words or those words that
contain the most information. The user supplies a frequency or
information cutoff and chooses to have the results sorted on either
value. The program will find the top 100 words that achieve the
cutoff values and present them to the user sorted as selected. The
information content will be calcutated from either Dw or Ds
depending which was used to create Dh and using the current
composition setting. Typical dialogue follows:
? Menu or option number=29
Looking for highest scoring words
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.6
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 4 Maximum information= 0.7385326
TTGACA 60 0.73850
AAAAAA 90 0.64880
TATAAT 65 0.62510
TTTTTT 115 0.60630
The highest word score = 115
? Minimum word score (0-115) (0) =50
? Minimum information (0.00-1.00) (0.00) =.5
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 8 Maximum information= 0.7385326
TTGACA 60 0.73850
TCTTGA 54 0.66080
AAAAAA 90 0.64880
TATAAT 65 0.62510
ACTTTA 57 0.61960
TTTTTT 115 0.60630
AGTATA 51 0.60540
TTATAA 55 0.59300
The highest word score = 115
? Minimum word score (0-115) (0) =50
? Minimum information (0.00-1.00) (0.00) =
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 8 Maximum information= 0.7385326
TTGACA 60 0.73850
TCTTGA 54 0.66080
AAAAAA 90 0.64880
TATAAT 65 0.62510
ACTTTA 57 0.61960
TTTTTT 115 0.60630
AGTATA 51 0.60540
TTATAA 55 0.59300
The highest word score = 115
? Minimum word score (0-115) (0) =!
@30. B 1 @Examine words in Dm
Examine words in Dm allows users to analyse the contents of
dictonary Dm at the level of individual words to find their
frequency, information content, and to see their base frequency
table. The user types in a word to examine and the program displays
the values and table. The information content will be calcutated
from either Dw or Ds depending which was used to create Dm, and
using the current composition setting. Typical dialogue follows:
? Menu or option number=30
? Word to examine=TTGACA
TtgacA 60 0.7385326
56 56 6 7 5 11
4 3 2 1 52 1
1 4 2 53 3 48
3 1 54 3 4 4
TTGACA
? Word to examine=TATAAT
taTAat 65 0.6251902
56 3 53 4 4 60
6 1 5 5 5 3
3 60 5 57 57 4
4 5 6 3 3 2
TATAAT
? Word to examine=
@31. B 1 @Examine words in Dh
Examine words in Dh allows users to analyse the contents of
dictonary Dh at the level of individual words to find their
frequency, information content, and to see their base frequency
table. The user types in a word to examine and the program displays
the values and table. The information content will be calcutated
from either Dw or Ds depending which was used to create Dm, and
using the current composition setting. Typical dialogue follows:
? Menu or option number=31
? Word to examine=TTGACA
TtgacA 60 0.7385326
56 56 6 7 5 11
4 3 2 1 52 1
1 4 2 53 3 48
3 1 54 3 4 4
TTGACA
? Word to examine=TATAAT
taTAat 65 0.6251902
56 3 53 4 4 60
6 1 5 5 5 3
3 60 5 57 57 4
4 5 6 3 3 2
TATAAT
? Word to examine=GGGGGG
gggggg 0 0.6199890
3 1 1 2 3 4
1 3 1 2 2 1
2 1 1 1 1 1
11 12 14 12 11 11
GGGGGG
? Word to examine=
@32. B 1 @Save or restore a dictionary
Save or restore dictionary allows users to write or read any
dictionary to and from disk files. The user is asked te define the
dictionary and file. The function is useful if the machine being
used is very slow at calculating because the files can be handled
quickly. However note that the files cannot be processed by any
other program.
@33. B 1 @Find inverted repeats
Find inverted repeats performs searches for simple inverted repeat
sequences in each sequence. They are defined by a range of loop
sizes and a minimum number of potential basepairs. The results can
be plotted or listed. The x axis of the plot represents the length
of the aligned sequences and the y direction is divided into
sufficient strips to accommodate each sequence. So if an inverted
repeat is found in the 3rd sequence at a position equivalent to
halfway along the longest of the sequences then a short vertical
line will be drawn at the midpoint of the 3rd strip. Alternatively,
if the results are listed, the potential hairpin loops are drawn
out, with the sequence number and the position of the loop. Typical
dialogue follows.
? Menu or option number=33
Define the range of loop sizes
? Minimum loop size (0-10) (3) =0
? Maximum loop size (1-20) (3) =
? Minimum number of basepairs (1-20) (6) =
? (y/n) (y) Plot results N
Searching
Sequence 3 34
C
G.T
T-A
A-T
T.G
T.G
G.T
ATCTTT TATTTCA
33
Sequence 5 35
T
G.T
T.G
A-T
T.G
G.T
C-G
T.G
TCCGGC AATTGTG
34
@ End of help

32
help/mem_menu Normal file
View file

@ -0,0 +1,32 @@
0 1 15 184 B MEP
1 1 9304 37 B Help
2 1 10465 2 B Quit
3 1 10531 14 B Read a new sequence.
4 1 10932 6 B Define active region
5 1 11250 31 B List a sequence.
6 1 12393 3 B List a text file.
7 1 12525 12 B Direct output to disk
10 1 12996 2 B Clear graphics
11 1 13065 2 B Clear text
12 1 13126 12 B Draw a ruler.
13 1 13871 12 B Use crosshair.
14 1 14459 34 B Reposition plots
15 1 16611 12 B Label a diagram
16 1 17394 12 B Display a map.
17 1 18154 31 B Search for strings
18 1 19507 3 B Set strand
19 1 19672 6 B Set composition
20 1 20013 3 B Set word length
21 1 20131 3 B Set number of mismatches
22 1 20256 14 B Show settings
23 1 20718 3 B Make dictionary Dw
24 1 20890 3 B Make dictionary Ds
25 1 21055 7 B Make dictionary Dm from Dw
26 1 21505 7 B Make dictionary Dm from Ds
27 1 21955 5 B Make dictionary Dh from Dm
28 1 22245 55 B Examine dictionary Dm
29 1 24148 70 B Examine dictionary Dh
30 1 26410 25 B Examine words in Dm
31 1 27437 33 B Examine words in Dh
32 1 28701 7 B Save or restore a dictionary
33 1 29106 46 B Find inverted repeats

792
help/mep_help Normal file
View file

@ -0,0 +1,792 @@
@-1. TX 0 @General
@-2. T 0 @Screen control
@-2. X 0 @Screen
@-3. TX 0 @Dictionary analysis
@0. TX -1 @MEP
This is a program for analysing families of nucleotide
sequences in order to find common motifs and potential binding
sites. The ideas in this program were described in Staden, R.
"Methods for discovering novel motifs in nucleic acid sequences".
Computer Applications in the Biosciences, 5, 293-298, (1989).
The program can read sequences stored in either of two
formats: 1) all sequences aligned in a single file; 2) all sequences
in separate files and accessed through a file of file names.
The program contains functions that can answer several
questions about a set of sequences:
Which words are most common?
Which words occur in the most sequences?
Which words contain the most information?
Which words occur in equivalent positions in the sequences?
Which words are inverted repeats?
Which words occur on both strands of the sequences?
Where are the inverted repeats?
Where are the fuzzy words?
Most of the program is concerned with analysing what it terms
"fuzzy words" within the set of sequences. The analysis is explained
below. Note that the standard version of the programs is limited to
words of maximum length 8 letters, and a maximum fuzziness of 2.
The following analyses (preceded by their option numbers) are
included:
? = Help
! = Quit
3 = Read new sequences
4 = Redefine active region
5 = List the sequences
6 = List text file
7 = Direct output to disk
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Reset margins
15 = Label diagram
16 = Draw map
17 = Search for strings
18 = Set strand
19 = Set composition
20 = Set word length
21 = Set number of mismatches
22 = Show settings
23 = Make dictionary Dw
24 = Make dictionary Ds
25 = Make fuzzy dictionary Dm from Dw
26 = Make fuzzy dictionary Dm from Ds
27 = Make fuzzy dictionary Dh from Dm
28 = Examine fuzzy dictionary Dm
29 = Examine fuzzy dictionary Dh
30 = Examine words in Dm
31 = Examine words in Dh
32 = Save or restore a dictionary
33 = Find inverted repeats
Some of these methods produce graphical results and so the
program is generally used from a graphics terminal (a vdu on which
lines and points can be drawn as well as characters).
The positions of each of the plots is defined relative to a users
drawing board which has size 1-10,000 in x and 1-10,000 in y. Plots
for each option are drawn in a window defined by x0,y0 and
xlength,ylength. Where x0,y0 is the position of the bottom left hand
corner of the window, and xlength is the width of the window and
ylength the height of the window.
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "MEPMARG" when the
program is started. Users can have their own file if required.
The options for the program are accessed from 3 main menus:
general, screen control and dictionary analylsis. Both menus and
options are selected by number.
The most important and novel part of the program is its use of
"fuzzy dictionaries" and an information theory measure, to help show
the most interesting motifs. Central to the method is the idea of a
fuzzy dictionary of word frequencies. A dictionary of word
frequencies is an ordered list of all the words in the sequences and
a count of the number of times that they occur. A fuzzy dictionary
is an equivalent list but which contains instead, for each word, a
count of the number of times similar words occur in the sequences.
We term words that are similar "relations". The fuzziness is defined
by the number of letters in a word that are allowed to be different.
So if we had a fuzziness of 1 we allow 1 letter to be different. For
example, with a fuzziness of 1, the entry in the fuzzy dictionary
for the word TTTTTT would contain a count of the numbers of times
TTTTTT occured plus the number of times all words differing by
exactly one letter from TTTTTT occured.
Once the fuzzy dictionary has been created we can examine it
in several ways to find candidate control sequences. The simplest
question we can ask is which word in the dictionary is the most
common. Sometimes this simple criterion of "most common" may be
adequate to discover a new motif but in general we would not expect
it to be sufficient. For example some words will be common simply
because of a base composition bias in the sequences being analysed.
In addition a word can be the most frequent and yet not be "well
defined". This last point is best explained by an example.
Suppose we were looking at two letter words and allowing one
mismatch, and that there were 10 occurences of TT and 5 of AC. We
could align the 10 words that were one letter different from TT and
the 5 that were related to AC. Then we could count the number of
times each base occured in each position for each of these two sets
of words. Suppose we got the two base frequency tables shown below.
TT AC
T 6 4 T 1 0
C 1 3 C 0 4
A 1 2 A 4 1
G 2 1 G 0 0
These tables show that although TT occurs (with one letter mismatch)
more often than AC, the ratio of base frequencies for AC at 4/5, 4/5
is higher than those for TT at 6/10, 4/10. Hence we would say that
AC was better defined than TT. Expressing this another way we would
say that the definition of AC contained more information than that
for TT. The program calculates the information content in a way that
takes into account both the sequence composition and the level of
definition of the motif.
Definitions
Here we deal only with the dictionary analysis. Suppose we
are dealing with a set of sequences and are examining them for words
that are six characters in length.
Dictionary Dw contains a count of the number of times each
word occurs in the set of sequences. For example the entry for
TTTTTT contains a value equal to the number of times the word TTTTTT
occurs in the set of sequences.
Dictionary Ds contains a count of the number of different
sequences in which each word occurs. For example if the entry for
word TTTTTT contains the value 10, it denotes that the word TTTTTT
occurs in ten different sequences. Unlike Dw it only counts words
once for each sequence. For example if we had a set of 100
sequences, the maximum possible value that Ds could take is 100, and
this would only happen if a word occurred in every sequence. However
for the same set of sequences, Dw could contain values greater than
100, and this would show that a word had occurred more than once in
at least one sequence.
From either of the two dictionaries Dw or Ds we can calculate
a fuzzy dictionary Dm. For each word, the entry in the fuzzy
dictionary Dm contains the sum of the dictionary values (taken from
either Dw or Ds) for all words that differ from it by up to m
letters. For example if m=2 the entry for TTTTTT contains the number
of times that TTTTTT occurs in the dictionary, plus the counts for
all words that differ from TTTTTT by 1 or 2 letters. Obviously the
interpretation of the values in Dm depends on which of the two
dictionaries Dw or Ds they were derived from. When derived from Dw
the entry for any word in Dm gives the total number of times it, and
its relations, occur in the set of sequences. When derived from Ds
the entry for any word in Dm gives the total number of different
sequences that contain a word and each of its relations.
Finally, from fuzzy dictionary Dm we can derive fuzzy
dictionary Dh. All entries in Dh are zero except for the word(s),
within each set of relations, that are most frequent. For example if
TTTTTT occurred 20 times but had a relation that occurred more
often, then the entry for TTTTTT would be zero. However if TTTTTT
did not have a more frequently occurring relation, then the entry
for TTTTTT would contain the value 20.
@1. T 0 @Help
This option gives online help. The user should select option
numbers and the current documentation will be given. Note that
option 0 gives an introduction to the program, and that ? will get
help from anywhere in the program. The following analyses (preceded
by their option numbers) are included:
? = Help
! = Quit
3 = Read new sequences
4 = Redefine active region
5 = List the sequences
6 = List text file
7 = Direct output to disk
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Reset margins
15 = Label diagram
16 = Draw map
17 = Search for strings
18 = Set strand
19 = Set composition
20 = Set word length
21 = Set number of mismatches
22 = Show settings
23 = Make dictionary Dw
24 = Make dictionary Ds
25 = Make fuzzy dictionary Dm from Dw
26 = Make fuzzy dictionary Dm from Ds
27 = Make fuzzy dictionary Dh from Dm
28 = Examine fuzzy dictionary Dm
29 = Examine fuzzy dictionary Dh
30 = Examine words in Dm
31 = Examine words in Dh
32 = Save or restore a dictionary
33 = Find inverted repeats
@2. T 0 @Quit
This function stops the program.
@3. TX 1 @Read a new sequence
It can read sequences stored in either of two formats: 1) all
sequences aligned in a single file; 2) all sequences in separate
files and accessed through a file of file names. Typical dialogue
follows:
X 1 Read file of aligned sequences
2 Use file of file names
? 0,1,2 =
? File of aligned sequences=F1
Number of files 88
@4. TX 1 @Define active region
For its analytic functions the program always works on a
region of the sequence called the active region. When new sequences
are read into the program the active region is automatically set to
start at the beginning of the sequences and go up to the end of the
longest one.
@5. TX 1 @List a sequence
The sequence can be listed with line lengths of 50 bases with
each sequence numbered in the order in which they were read. Output
can be directed to a disk file by first selecting disk output.
Typical dialogue follows.
? Menu or option number=5
10 20 30 40 50
1 TAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCA
2 CAAATAATCAATGTGGACTTTTCTGCCGTGATTATAGACACTTTTGTTAC
3 TAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTATT
4 ACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTA
5 AGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
6 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGC
7 ACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCG
8 GGGGCAAGGAGGATGGAAAGAGGTTGCCGTATAAAGAAACTAGAGTCCGT
9 AGGGGGTGGAGGATTTAAGCCATCTCCTGATGACGCATAGTCAGCCCATC
10 AAAACGTCATCGCTTGCATTAGAAAGGTTTCTGGCCGACCTTATAACCAT
60
1 TACCCGTTTTT
2 GCGTTTTTGT
3 TCATACCATAAG
4 TTTCATACC
5 ATTGTGAGC
6 TTCCGGCTCG
7 GAAGAGAGT
8 TCAGGTGT
9 ATGAATG
10 TAATTACG
@6. TX 1 @List a text file
Allows the user to have a text file displayed on the screen.
It will appear one page at a time.
@7. TX 1 @Direct output to disk
Used to direct output that would normally appear on the screen
to a file.
Select redirection of either text or graphics, and supply the
name of the file that the output should be written to.
The results from the next options selected will not appear on
the screen but will be written to the file. When option 7 is
selected again the file will be closed and output will again appear
on the screen.
@10. TX 2 @Clear graphics
Clears the screen of both text and graphics.
@11. TX 2 @Clear text
Clears only text from the screen.
@12. TX 2 @Draw a ruler
This option allows the user to draw a ruler or scale along the
x axis of the screen to help identify the coordinates of points of
interest. The user can define the position of the first amino acid
to be marked (for example if the active region is 1501 to 8000, the
user might wish to mark every 1000th amino acid starting at either
1501 or 2000 - it depends if the user wishes to treat the active
region as an independent unit with its own numbering starting at its
left edge, or as part of the whole sequence). The user can also
define the separation of the ticks on the scale and their height. If
required the labelling routine can be used to add numbers to the
ticks.
@13. TX 2 @Use crosshair
This function puts a steerable cross on the screen that can be
used to find the coordinates of points in the sequence. The user can
move the cross around using the directional keys; when he hits the
space bar the program will print out the coordinates of the cross in
sequence units and the option will be exited.
If instead, you hit a , the position will be displayed but the
cross will remain on the screen.
If a letter s is hit the sequence around the cross hair is
displayed and the cross remains on the screen.
@14. TX 2 @Reposition plots
The positions of each of the plots is defined relative to a
users drawing board which has size 1-10,000 in x and 1-10,000 in y.
Plots for each option are drawn in a window defined by x0,y0 and
xlength,ylength. Where x0,y0 is the position of the bottom left hand
corner of the window, and xlength is the width of the window and
ylength the height of the window.
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "MEPMARG" when the
program is started. Users can have their own file if required. As
all the plots start at the same position in x and have the same
width, x0 and xlength are the same for all options. Generally users
will only want to change the start level of the window y0 and its
height ylength. This option allows users to change window positions
whilst running the program. The routine prompts first for the
number of the option that the users wishes to reposition; then for
the y start and height; then for the x start and length. Note that
changes to the x values affect all options. If the user types only
carriage return for any value it will remain unchanged. The cross-
hair can be used to choose suitable heights.
@15. TX 2 @Label a diagram
This routine allows users to label any diagrams they have
produced. They are asked to type in a label. When the user types
carriage return to finish typing the label the cross-hair appears on
the screen. The user can position it anywhere on the screen. If the
user types R (for right justify) the label will be written on the
diagram with its right end at the cross-hair position. If the user
types L (for left justify) the label will be written on the diagram
with its left end at the cross hair position. The cross-hair will
then immediately reappear. The user may put the same label on
another part of the diagram as before or if he hits the space bar he
will be asked if he wishes to type in another label.
@16. TX 2 @Display a map
It is often convenient to plot a map alongside graphed
analysis in order to indicate features within the sequence. This
function allows users to draw maps using files arranged in the form
of EMBL feature tables. Of course the EMBL table are usually only
used for nucleic acid sequence annotation but, as long as the
features are written in the correct format, they can be employed by
this routine. The map is composed of a line representing the
sequence and then further lines denoting the endpoints of each
feature the user identifies. The user is asked to define height at
which the line representing the sequence should be drawn; then for
the feature height; then for the features to plot.
@17. TX 1 @Search for strings
Search for strings perfoms searches of all the sequences for
selected words and shows which sequences they are found in. The user
types in a word and defines the allowed number of mismatches. The
results are listed or plotted. If listed the display includes the
sequence number, the position in the sequence and the matching
string. The results are plotted in the following way. The x axis of
the plot represents the length of the aligned sequences and the y
direction is divided into sufficient strips to accommodate each
sequence. So if a match is found in the 3rd sequence at a position
equivalent to halfway along the longest of the sequences then a
short vertical line will be drawn at the midpoint of the 3rd strip.
If the sequences are aligned it can be useful if the motifs happen
to appear in related positions. For example see the original
publication. Typical dialogue follows.
? Menu or option number=17
X 1 Plot match positions
2 Plot histogram of matches
? 0,1,2 =
? Word to search for=TTGACA
? Minimum match (0-6) (6) =5
? (y/n) (y) Plot results N
2 35 TAGACA
5 14 TTTACA
6 37 TTTACA
11 14 TAGACA
14 14 TTGACA
17 14 GTGACA
17 22 TTAACA
20 1 TTGACA
@18. TX 3 @Set strand
Set strand allows the user to define which strand(s) of the
sequences to analyse: input stand, complement of input, or both.
@19. TX 3 @Set composition
Set composition gives the user three choices for setting the
composition of the sequences for use in the calculation of the
information content of words. The user can select the overall
composition of the sequences as read, an even composition, or can
type in any other 4 values.
@20. TX 3 @Set word length
Set word length sets the length of word for which dictionaries
will be made.
@21. TX 3 @Set number of mismatches
Set number of mismatches sets the level of fuzziness for the
creation of dictionary Dm.
@22. TX 3 @Show settings
Show settings show the current settings for all parameters
associated with dictionary analysis. A typical diaplsy follows:
? Menu or option number=22
Current word length = 6
Number of mismatches = 1
Start position = 1
End position = 63
Input strand only
Observed composition
Dictionary Dw unmade
Dictionary Ds unmade
Dictionary Dm unmade
Dictionary Dh unmade
@23. TX 3 @Make dictionary Dw
Make dictionary Dw creates a dictionary that contains a count
of the frequency of occurrence of each word in the collected
sequences.
@24. TX 3 @Make dictionary Ds
Make dictionary Ds creates a dictionary that contains a count
of the number of different sequences that contain each word.
@25. TX 3 @Make dictionary Dm from Dw
Make dictionary Dm from Dw creates a dictionary from
dictionary Dw that contains the frequency of occurrence of each word
(say X) in Dw plus the frequency of occurrence of each word in Dw
that differs from X by up to m letters. Dm is called a fuzzy
dictionary as it contains the frequencies of occurrence of all words
plus the frequencies of all the words that are similar to them.
@26. TX 3 @Make dictionary Dm from Ds
Make dictionary Dm from Ds creates a dictionary from
dictionary Ds that contains the frequency of occurrence of each word
(say X) in Ds plus the frequency of occurrence of each word in Ds
that differs from X by up to m letters. Dm is called a fuzzy
dictionary as it contains the frequencies of occurrence of all words
plus the frequencies of all the words that are similar to them.
@27. TX 3 @Make dictionary Dh from Dm
Make dictionary Dh creates a dictionary from dictionary Dm
and whose entries are zero except for those words in any set of
related words that are most frequent. It finds the dominant words in
each set of relations and stores their counts.
@28. TX 3 @Examine fuzzy dictionary Dm
Examine dictionary Dm allows users to analyse the contents of
dictionary Dm to find the most common words or those words that
contain the most information. The user supplies a frequency or
information cutoff and chooses to have the results sorted on either
value. The program will find the top 100 words that achieve the
cutoff values and present them to the user sorted as selected. The
information content will be calcutated from either Dw or Ds
depending which was used to create Dm, and using the current
composition setting. Typical dialogue follows:
? Menu or option number=28
Looking for highest scoring words
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.62
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 9 Maximum information= 0.7385326
TTGACA 60 0.73850
AAAAAC 64 0.66460
AAAAAA 90 0.64880
GTTTTT 66 0.64300
TTTTTG 73 0.64070
TTTTGT 63 0.63820
TTTTTC 65 0.63810
AAAATA 63 0.62670
TATAAT 65 0.62510
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.62
X 1 Sort on information
2 Sort on word score
? 0,1,2 =2
? Maximum number to list (0-100) (100) =
The words are
Total words= 9 Maximum information= 0.7385326
AAAAAA 90 0.64880
TTTTTG 73 0.64070
GTTTTT 66 0.64300
TTTTTC 65 0.63810
TATAAT 65 0.62510
AAAAAC 64 0.66460
TTTTGT 63 0.63820
AAAATA 63 0.62670
TTGACA 60 0.73850
The highest word score = 115
? Minimum word score (0-115) (0) =!
@29. TX 3 @Examine fuzzy dictionary Dh
Examine dictionary Dh allows users to analyse the contents of
dictionary Dh to find the most common words or those words that
contain the most information. The user supplies a frequency or
information cutoff and chooses to have the results sorted on either
value. The program will find the top 100 words that achieve the
cutoff values and present them to the user sorted as selected. The
information content will be calcutated from either Dw or Ds
depending which was used to create Dh and using the current
composition setting. Typical dialogue follows:
? Menu or option number=29
Looking for highest scoring words
The highest word score = 115
? Minimum word score (0-115) (0) =60
? Minimum information (0.00-1.00) (0.00) =.6
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 4 Maximum information= 0.7385326
TTGACA 60 0.73850
AAAAAA 90 0.64880
TATAAT 65 0.62510
TTTTTT 115 0.60630
The highest word score = 115
? Minimum word score (0-115) (0) =50
? Minimum information (0.00-1.00) (0.00) =.5
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 8 Maximum information= 0.7385326
TTGACA 60 0.73850
TCTTGA 54 0.66080
AAAAAA 90 0.64880
TATAAT 65 0.62510
ACTTTA 57 0.61960
TTTTTT 115 0.60630
AGTATA 51 0.60540
TTATAA 55 0.59300
The highest word score = 115
? Minimum word score (0-115) (0) =50
? Minimum information (0.00-1.00) (0.00) =
X 1 Sort on information
2 Sort on word score
? 0,1,2 =
? Maximum number to list (0-100) (100) =
The words are
Total words= 8 Maximum information= 0.7385326
TTGACA 60 0.73850
TCTTGA 54 0.66080
AAAAAA 90 0.64880
TATAAT 65 0.62510
ACTTTA 57 0.61960
TTTTTT 115 0.60630
AGTATA 51 0.60540
TTATAA 55 0.59300
The highest word score = 115
? Minimum word score (0-115) (0) =!
@30. TX 3 @Examine words in Dm
Examine words in Dm allows users to analyse the contents of
dictonary Dm at the level of individual words to find their
frequency, information content, and to see their base frequency
table. The user types in a word to examine and the program displays
the values and table. The information content will be calcutated
from either Dw or Ds depending which was used to create Dm, and
using the current composition setting. Typical dialogue follows:
? Menu or option number=30
? Word to examine=TTGACA
TtgacA 60 0.7385326
56 56 6 7 5 11
4 3 2 1 52 1
1 4 2 53 3 48
3 1 54 3 4 4
TTGACA
? Word to examine=TATAAT
taTAat 65 0.6251902
56 3 53 4 4 60
6 1 5 5 5 3
3 60 5 57 57 4
4 5 6 3 3 2
TATAAT
? Word to examine=
@31. TX 3 @Examine words in Dh
Examine words in Dh allows users to analyse the contents of
dictonary Dh at the level of individual words to find their
frequency, information content, and to see their base frequency
table. The user types in a word to examine and the program displays
the values and table. The information content will be calcutated
from either Dw or Ds depending which was used to create Dm, and
using the current composition setting. Typical dialogue follows:
? Menu or option number=31
? Word to examine=TTGACA
TtgacA 60 0.7385326
56 56 6 7 5 11
4 3 2 1 52 1
1 4 2 53 3 48
3 1 54 3 4 4
TTGACA
? Word to examine=TATAAT
taTAat 65 0.6251902
56 3 53 4 4 60
6 1 5 5 5 3
3 60 5 57 57 4
4 5 6 3 3 2
TATAAT
? Word to examine=GGGGGG
gggggg 0 0.6199890
3 1 1 2 3 4
1 3 1 2 2 1
2 1 1 1 1 1
11 12 14 12 11 11
GGGGGG
? Word to examine=
@32. TX 3 @Save or restore a dictionary
Save or restore dictionary allows users to write or read any
dictionary to and from disk files. The user is asked te define the
dictionary and file. The function is useful if the machine being
used is very slow at calculating because the files can be handled
quickly. However note that the files cannot be processed by any
other program.
@33. TX 1 @Find inverted repeats
Find inverted repeats performs searches for simple inverted
repeat sequences in each sequence. They are defined by a range of
loop sizes and a minimum number of potential basepairs. The results
can be plotted or listed. The x axis of the plot represents the
length of the aligned sequences and the y direction is divided into
sufficient strips to accommodate each sequence. So if an inverted
repeat is found in the 3rd sequence at a position equivalent to
halfway along the longest of the sequences then a short vertical
line will be drawn at the midpoint of the 3rd strip. Alternatively,
if the results are listed, the potential hairpin loops are drawn
out, with the sequence number and the position of the loop. Typical
dialogue follows.
? Menu or option number=33
Define the range of loop sizes
? Minimum loop size (0-10) (3) =0
? Maximum loop size (1-20) (3) =
? Minimum number of basepairs (1-20) (6) =
? (y/n) (y) Plot results N
Searching
Sequence 3 34
C
G.T
T-A
A-T
T.G
T.G
G.T
ATCTTT TATTTCA
33
Sequence 5 35
T
G.T
T.G
A-T
T.G
G.T
C-G
T.G
TCCGGC AATTGTG
34
@ End of help

68
help/mep_menu Normal file
View file

@ -0,0 +1,68 @@
-1 0 22 2 T General
-1 0 22 2 X General
-2 0 51 2 T Screen control
-2 0 72 2 X Screen
-3 0 106 2 T Dictionary analysis
-3 0 106 2 X Dictionary analysis
0 -1 124 185 T MEP
0 -1 124 185 X MEP
1 0 9423 38 T Help
2 0 10594 3 T Quit
3 1 10667 14 T Read a new sequence
3 1 10667 14 X Read a new sequence
4 1 11069 7 T Define active region
4 1 11069 7 X Define active region
5 1 11396 32 T List a sequence
5 1 11396 32 X List a sequence
6 1 12548 4 T List a text file
6 1 12548 4 X List a text file
7 1 12690 12 T Direct output to disk
7 1 12690 12 X Direct output to disk
10 2 13162 3 T Clear graphics
10 2 13162 3 X Clear graphics
11 2 13239 3 T Clear text
11 2 13239 3 X Clear text
12 2 13307 13 T Draw a ruler
12 2 13307 13 X Draw a ruler
13 2 14053 13 T Use crosshair
13 2 14053 13 X Use crosshair
14 2 14643 35 T Reposition plots
14 2 14643 35 X Reposition plots
15 2 16797 13 T Label a diagram
15 2 16797 13 X Label a diagram
16 2 17589 13 T Display a map
16 2 17589 13 X Display a map
17 1 18384 32 T Search for strings
17 1 18384 32 X Search for strings
18 3 19739 4 T Set strand
18 3 19739 4 X Set strand
19 3 19906 7 T Set composition
19 3 19906 7 X Set composition
20 3 20249 4 T Set word length
20 3 20249 4 X Set word length
21 3 20374 4 T Set number of mismatches
21 3 20374 4 X Set number of mismatches
22 3 20501 15 T Show settings
22 3 20501 15 X Show settings
23 3 20965 5 T Make dictionary Dw
23 3 20965 5 X Make dictionary Dw
24 3 21152 4 T Make dictionary Ds
24 3 21152 4 X Make dictionary Ds
25 3 21326 8 T Make dictionary Dm from Dw
25 3 21326 8 X Make dictionary Dm from Dw
26 3 21787 8 T Make dictionary Dm from Ds
26 3 21787 8 X Make dictionary Dm from Ds
27 3 22248 6 T Make dictionary Dh from Dm
27 3 22248 6 X Make dictionary Dh from Dm
28 3 22551 56 T Examine fuzzy dictionary Dm
28 3 22551 56 X Examine fuzzy dictionary Dm
29 3 24462 71 T Examine fuzzy dictionary Dh
29 3 24462 71 X Examine fuzzy dictionary Dh
30 3 26726 26 T Examine words in Dm
30 3 26726 26 X Examine words in Dm
31 3 27755 34 T Examine words in Dh
31 3 27755 34 X Examine words in Dh
32 3 29021 8 T Save or restore a dictionary
32 3 29021 8 X Save or restore a dictionary
33 1 29428 45 T Find inverted repeats
33 1 29428 45 X Find inverted repeats

4620
help/nip_help Normal file
View file

File diff suppressed because it is too large Load diff

156
help/nip_menu Normal file
View file

@ -0,0 +1,156 @@
-1 0 22 2 T General
-1 0 22 2 X General
-2 0 51 2 T Screen control
-2 0 72 2 X Screen
-3 0 118 2 T Statistical analysis of content
-3 0 143 2 X Statistics
-4 0 180 2 T Structures and repeats
-4 0 205 2 X Structures
-5 0 242 2 T Translation and codons
-5 0 242 2 X Translation and codons
-6 0 279 2 T Gene search by content
-6 0 279 2 X Gene search by content
-7 0 309 2 T General signals
-7 0 309 2 X General signals
-8 0 340 2 T Specific signals
-8 0 340 2 X Specific signals
0 -1 359 16 T NIP
0 -1 359 16 X NIP
1 0 1155 7 T Help
1 0 1155 7 X Help
2 0 1469 3 T Quit
2 0 1469 3 X Quit
3 1 1543 220 T Read a new sequence
3 1 1543 220 X Read a new sequence
4 1 11372 15 T Define active region
4 1 11372 15 X Define active region
5 1 12100 24 T List a sequence
5 1 12100 24 X List a sequence
6 1 13103 6 T List a text file.
6 1 13103 6 X List a text file.
7 1 13300 12 T Direct output to disk
7 1 13300 12 X Direct output to disk
8 1 13785 10 T Write active region to disk
8 1 13785 10 X Write active region to disk
9 1 14128 31 T Edit the sequence
9 1 14128 31 X Edit the sequence
10 2 15970 3 T Clear graphics
10 2 15970 3 X Clear graphics
11 2 16036 3 T Clear text
11 2 16036 3 X Clear text
12 2 16101 12 T Draw a ruler
12 2 16101 12 X Draw a ruler
13 2 16833 13 T Use crosshair
13 2 16833 13 X Use crosshair
14 2 17443 35 T Reposition plots
14 2 17443 35 X Reposition plots
15 2 19598 28 T Label a diagram
15 2 19598 28 X Label a diagram
16 2 20703 34 T Display a map
16 2 20703 34 X Display a map
17 1 22073 599 T Search for restriction enzymes
17 1 22073 599 X Search for restriction enzymes
18 7 46675 105 T Compare a short sequence
18 1 46675 105 T Compare a short sequence
18 7 46675 105 X Compare a short sequence
18 1 46675 105 X Compare a short sequence
19 7 49650 106 T Compare a short sequence using a score matrix
19 7 49650 106 X Compare a short sequence using a score matrix
20 7 53349 230 T Search for a motif using a weight matrix
20 7 53349 230 X Search for a motif using a weight matrix
21 3 63267 4 T Count base composition
21 3 63267 4 X Count base composition
22 3 63440 14 T Count dinucleotide frequencies
22 3 63440 14 X Count dinucleotide frequencies
23 5 64100 179 T Count codons and amino acids
23 3 64100 179 T Count codons and amino acids
23 5 64100 179 X Count codons and amino acids
23 3 64100 179 X Count codons and amino acids
24 3 72137 57 T Plot base composition
24 3 72137 57 X Plot base composition
25 3 73213 23 T Plot local deviations in base composition
25 3 73213 23 X Plot local deviations in base composition
26 3 74495 23 T Plot local deviations from dinucleotide composition
26 3 74495 23 X Plot local deviations from dinucleotide composition
27 3 75793 23 T Plot local deviations from trinucleotide composition
27 3 75793 23 X Plot local deviations from trinucleotide composition
28 5 77065 18 T Calculate codon constraint
28 5 77065 18 X Calculate codon constraint
59 3 77869 12 T Plot negentropy
59 3 77869 12 X Plot negentropy
30 4 78454 74 T Search for hairpin loops
30 4 78454 74 X Search for hairpin loops
31 4 80321 23 T Search for long range inverted repeats
31 4 80321 23 X Search for long range inverted repeats
32 4 81157 37 T Search for repeats
32 4 81157 37 X Search for repeats
33 4 82467 12 T Search for z dna (total ry, yr)
33 4 82467 12 X Search for z dna (total ry, yr)
34 4 82984 12 T Search for z dna (runs of ry, yr)
34 4 82984 12 X Search for z dna (runs of ry, yr)
35 4 83623 15 T Search for z dna (best phased value)
35 4 83623 15 X Search for z dna (best phased value)
36 4 84350 92 T Local similarity or complementarity search
36 4 84350 92 X Local similarity or complementarity search
37 5 87778 39 T Set genetic code
37 5 87778 39 X Set genetic code
38 4 89050 74 T Examine repeats
38 3 89050 74 T Examine repeats
39 5 91670 286 T Translate and list in upto six phases
39 5 91670 286 X Translate and list in upto six phases
40 5 103780 134 T Translate and write the protein sequence to disk
40 5 103780 134 X Translate and write the protein sequence to disk
41 5 108198 71 T Calculate and write codon table to disk
41 5 108198 71 X Calculate and write codon table to disk
42 6 111525 132 T Codon usage method
42 6 111525 132 X Codon usage method
43 6 118508 182 T Positional base preference method.
43 6 118508 182 X Positional base preference method.
44 6 127924 39 T Uneven positional base frequencies.
44 6 127924 39 X Uneven positional base frequencies.
45 6 130287 33 T Codon improbability on base composition
45 6 130287 33 X Codon improbability on base composition
46 6 132146 28 T Codon improbability on amino acid composition
46 6 132146 28 X Codon improbability on amino acid composition
47 6 133744 14 T Shepherd RNY preference method
47 6 133744 14 X Shepherd RNY preference method
48 6 134410 30 T Ficketts method
48 6 134410 30 X Ficketts method
49 6 136094 139 T tRNA gene search.
49 6 136094 139 X tRNA gene search.
50 7 141894 4 T Plot start codons
50 7 141894 4 X Plot start codons
51 7 142027 4 T Plot stop codons
51 7 142027 4 X Plot stop codons
52 7 142188 4 T Plot stop codons on the complementary strand
52 7 142188 4 X Plot stop codons on the complementary strand
53 7 142365 4 T Plot stop codons on both strands
53 7 142365 4 X Plot stop codons on both strands
54 5 142536 45 T Search for longest open reading frames
54 5 142536 45 X Search for longest open reading frames
55 8 144437 67 T Search for E. coli promoter (general)
55 8 144437 67 X Search for E. coli promoter (general)
56 8 148004 4 T Search for E. coli promoter (general) strand
56 8 148004 4 X Search for E. coli promoter (general) strand
57 8 148210 4 T Search for E. coli promoter sequences. (-35 and -10)
57 8 148210 4 X Search for E. coli promoter sequences. (-35 and -10)
58 8 148405 44 T Search for procaryotic ribosome binding sites
58 8 148405 44 X Search for procaryotic ribosome binding sites
29 1 150862 4 T Reverse and complement the sequence
29 1 150862 4 X Reverse and complement the sequence
60 7 151001 142 T Search using a dinucleotide weight matrix
60 7 151001 142 X Search using a dinucleotide weight matrix
61 8 157292 31 T Search for eukaryotic ribosome binding sites
61 8 157292 31 X Search for eukaryotic ribosome binding sites
62 8 158730 56 T Search for splice junctions
62 8 158730 56 X Search for splice junctions
63 7 162089 7 T Search using a weight matrix (complementary)
63 7 162089 7 X Search using a weight matrix (complementary)
64 3 162471 36 T Plot observed-expected word frequencies
64 3 162471 36 X Plot observed-expected word frequencies
65 9 164175 5 T Search for polya sites
65 9 164175 5 X Search for polya sites
66 1 164369 4 T Interconvert t and u
66 1 164369 4 X Interconvert t and u
67 7 164520 797 T Search for patterns of motifs
67 7 164520 797 X Search for patterns of motifs

132
help/nipf_help Normal file
View file

@ -0,0 +1,132 @@
@-1. TX 0 @General
@-2. TX 0 @Screen control
@-3. TX 0 @Statistical analysis
@-1. TX 0 @General
@-2. TX 0 @Screen control
@-3. TX 0 @Statistical analysis
@0. TX -1 @NIPF
@1. TX 1 @ Help
@2. TX 1 @ Quit
@3. TX 1 @ Read new sequence
@4. TX 1 @ Redefine active region
@5. TX 1 @ List the sequence
@6. TX 1 @ List a text file
@7. TX 1 @ Direct output to disk
@8. TX 1 @ Write active sequence to disk
@9. TX 1 @ List a translation
@32. TX 1 @ List showing base differences
@37. TX 1 @ List showing translation
@33. TX 1 @ List showing amino acid differences
@10. TX 2 @ Clear graphics
@11. TX 2 @ Clear text
@12. TX 2 @ Draw a ruler
@13. TX 2 @ Use cross hair
@14. TX 2 @ Reset margins
@15. TX 2 @ Label diagram
@16. TX 2 @ Display a map
@17. TX 3 @ Set comparison mode
@18. TX 3 @ Set sort mode
@21. TX 3 @ Count base changes
@22. TX 3 @ Count codon changes
@23. TX 3 @ Count genetic events
@24. TX 3 @ Show table of base changes
@36. TX 3 @ Show table of expressed base changes
@39. TX 3 @ Show table of silent base changes
@38. TX 3 @ Estimate mutation rate
@25. TX 3 @ Plot base changes
@26. TX 3 @ Plot expressed changes per base
@27. TX 3 @ Plot silent changes per base
@28. TX 3 @ Count expressed changes per base
@29. TX 3 @ Count silent changes per base
@30. TX 3 @ Count changed amino acids
@31. TX 3 @ Plot amino acid variability
@ end of help

84
help/nipf_menu Normal file
View file

@ -0,0 +1,84 @@
-1 0 23 2 T General
-1 0 23 2 X General
-2 0 53 2 T Screen control
-2 0 53 2 X Screen control
-3 0 89 2 T Statistical analysis
-3 0 89 2 X Statistical analysis
-1 0 112 2 T General
-1 0 112 2 X General
-2 0 142 2 T Screen control
-2 0 142 2 X Screen control
-3 0 178 2 T Statistical analysis
-3 0 178 2 X Statistical analysis
0 -1 198 2 T NIPF
0 -1 198 2 X NIPF
1 1 217 2 T Help
1 1 217 2 X Help
2 1 236 2 T Quit
2 1 236 2 X Quit
3 1 268 2 T Read new sequence
3 1 268 2 X Read new sequence
4 1 305 2 T Redefine active region
4 1 305 2 X Redefine active region
5 1 337 2 T List the sequence
5 1 337 2 X List the sequence
6 1 368 2 T List a text file
6 1 368 2 X List a text file
7 1 404 2 T Direct output to disk
7 1 404 2 X Direct output to disk
8 1 448 2 T Write active sequence to disk
8 1 448 2 X Write active sequence to disk
9 1 481 2 T List a translation
9 1 481 2 X List a translation
32 1 525 2 T List showing base differences
32 1 525 2 X List showing base differences
37 1 564 2 T List showing translation
37 1 564 2 X List showing translation
33 1 614 2 T List showing amino acid differences
33 1 614 2 X List showing amino acid differences
10 2 643 2 T Clear graphics
10 2 643 2 X Clear graphics
11 2 668 2 T Clear text
11 2 668 2 X Clear text
12 2 695 2 T Draw a ruler
12 2 695 2 X Draw a ruler
13 2 724 2 T Use cross hair
13 2 724 2 X Use cross hair
14 2 752 2 T Reset margins
14 2 752 2 X Reset margins
15 2 780 2 T Label diagram
15 2 780 2 X Label diagram
16 2 808 2 T Display a map
16 2 808 2 X Display a map
17 3 842 2 T Set comparison mode
17 3 842 2 X Set comparison mode
18 3 870 2 T Set sort mode
18 3 870 2 X Set sort mode
21 3 903 2 T Count base changes
21 3 903 2 X Count base changes
22 3 937 2 T Count codon changes
22 3 937 2 X Count codon changes
23 3 972 2 T Count genetic events
23 3 972 2 X Count genetic events
24 3 1013 2 T Show table of base changes
24 3 1013 2 X Show table of base changes
36 3 1064 2 T Show table of expressed base changes
36 3 1064 2 X Show table of expressed base changes
39 3 1112 2 T Show table of silent base changes
39 3 1112 2 X Show table of silent base changes
38 3 1149 2 T Estimate mutation rate
38 3 1149 2 X Estimate mutation rate
25 3 1181 2 T Plot base changes
25 3 1181 2 X Plot base changes
26 3 1227 2 T Plot expressed changes per base
26 3 1227 2 X Plot expressed changes per base
27 3 1270 2 T Plot silent changes per base
27 3 1270 2 X Plot silent changes per base
28 3 1317 2 T Count expressed changes per base
28 3 1317 2 X Count expressed changes per base
29 3 1361 2 T Count silent changes per base
29 3 1361 2 X Count silent changes per base
30 3 1401 2 T Count changed amino acids
30 3 1401 2 X Count changed amino acids
31 3 1443 2 T Plot amino acid variability
31 3 1443 2 X Plot amino acid variability

2244
help/pip_help Normal file
View file

File diff suppressed because it is too large Load diff

80
help/pip_menu Normal file
View file

@ -0,0 +1,80 @@
-1 0 21 2 T General
-1 0 21 2 X General
-2 0 50 2 T Screen control
-2 0 71 2 X Screen
-3 0 117 2 T Statistical analysis of content
-3 0 142 2 X Statistics
-4 0 179 2 T Structures and repeats
-4 0 204 2 X Structures
-5 0 225 2 T Search
-5 0 225 2 X Search
0 -1 243 76 T PIP
0 -1 243 76 X PIP
1 0 3546 8 T Help
1 0 3546 8 X Help
2 0 3889 3 T Quit
2 0 3889 3 X Quit
3 1 3962 220 T Read a new sequence
3 1 3962 220 X Read a new sequence
4 1 13792 12 T Redefine active region
4 1 13792 12 X Redefine active region
5 1 14480 33 T List a sequence
5 1 14480 33 X List a sequence
6 1 15941 4 T List a text file
6 1 15941 4 X List a text file
7 1 16083 12 T Direct output to disk
7 1 16083 12 X Direct output to disk
8 1 16567 7 T Write active region to disk
8 1 16567 7 X Write active region to disk
9 1 16922 26 T Edit the sequence
9 1 16922 26 X Edit the sequence
10 2 18386 3 T Clear graphics
10 2 18386 3 X Clear graphics
11 2 18463 3 T Clear text
11 2 18463 3 X Clear text
12 2 18531 13 T Draw a ruler
12 2 18531 13 X Draw a ruler
13 2 19278 13 T Use cross hair
13 2 19278 13 X Use cross hair
14 2 19865 35 T Reset margins
14 2 19865 35 X Reset margins
15 2 22019 13 T Label a diagram
15 2 22019 13 X Label a diagram
16 2 22811 13 T Display a map
16 2 22811 13 X Display a map
17 5 23611 254 T Short sequence search
17 1 23611 254 T Short sequence search
17 5 23611 254 X Short sequence search
17 1 23611 254 X Short sequence search
18 5 34012 57 T Compare a sequence
18 1 34012 57 T Compare a sequence
18 5 34012 57 X Compare a sequence
18 1 34012 57 X Compare a sequence
19 5 35654 69 T Compare a sequence using a score matrix
19 1 35654 69 T Compare a sequence using a score matrix
19 5 35654 69 X Compare a sequence using a score matrix
19 1 35654 69 X Compare a sequence using a score matrix
20 5 37587 214 T Search for a motif using a weight matrix
20 5 37587 214 X Search for a motif using a weight matrix
21 3 46771 20 T Calculate amino acid composition
21 3 46771 20 X Calculate amino acid composition
22 4 47655 20 T Plot hydrophobicity
22 3 47655 20 T Plot hydrophobicity
22 4 47655 20 X Plot hydrophobicity
22 3 47655 20 X Plot hydrophobicity
23 4 48439 19 T Plot charge
23 3 48439 19 T Plot charge
23 4 48439 19 X Plot charge
23 3 48439 19 X Plot charge
24 4 48953 72 T Plot robson prediction
24 4 48953 72 X Plot robson prediction
26 4 51912 32 T Draw a helix wheel
26 4 51912 32 X Draw a helix wheel
25 4 53561 36 T Plot hydrophobic moment
25 3 53561 36 T Plot hydrophobic moment
25 4 53561 36 X Plot hydrophobic moment
25 3 53561 36 X Plot hydrophobic moment
27 1 55101 87 T Back translate to dna
27 1 55101 87 X Back translate to dna
28 5 59337 809 T Search for patterns of motifs
28 5 59337 809 X Search for patterns of motifs

1848
help/sap_help Normal file
View file

File diff suppressed because it is too large Load diff

76
help/sap_menu Normal file
View file

@ -0,0 +1,76 @@
-1 0 21 2 T General
-1 0 21 2 X General
-2 0 50 2 T Screen control
-2 0 71 2 X Screen
-3 0 98 2 T Modification
-3 0 98 2 X Modification
0 -1 116 379 T SAP
0 -1 116 379 X SAP
17 1 19213 18 T Screen against restriction enzymes
17 1 19213 18 X Screen against restriction enzymes
18 1 20256 22 T Screen against vector
18 1 20256 22 X Screen against vector
20 2 21583 113 T Auto assemble
20 2 21583 113 X Auto assemble
28 1 27744 42 T Highlight disagreements
28 1 27744 42 X Highlight disagreements
32 3 30106 22 T Extract gel readings
32 3 30106 22 X Extract gel readings
1 0 31209 3 T Help
1 0 31209 3 X Help
2 0 31277 5 T Help
2 0 31277 5 X Help
3 1 31470 175 T Open a database
3 1 31470 175 X Open a database
4 3 40550 64 T Edit
4 3 40550 64 X Edit
9 3 43796 40 T Screen edit
9 3 43796 40 X Screen edit
5 1 45923 45 T Display a contig
5 1 45923 45 X Display a contig
6 1 48409 6 T List a text file
6 1 48409 6 X List a text file
8 1 48667 94 T Calculate a consensus
8 1 48667 94 X Calculate a consensus
25 1 53186 41 T Show relationships
25 1 53186 41 X Show relationships
21 3 55121 99 T Enter new gel reading
21 3 55121 99 X Enter new gel reading
23 3 60131 11 T Complement a contig
23 3 60131 11 X Complement a contig
22 3 60644 70 T Join contigs
22 3 60644 70 X Join contigs
24 1 64235 11 T Copy the database
24 1 64235 11 X Copy the database
19 1 64781 41 T Check database
19 1 64781 41 X Check database
29 1 66799 82 T Examine quality
29 1 66799 82 X Examine quality
26 3 70617 92 T Alter relationships
26 3 70617 92 X Alter relationships
27 1 75377 17 T Set display parameters
27 1 75377 17 X Set display parameters
30 3 76245 48 T Auto edit a contig
30 3 76245 48 X Auto edit a contig
10 2 78721 3 T Clear graphics
10 2 78721 3 X Clear graphics
11 2 78786 3 T Clear text
11 2 78786 3 X Clear text
12 2 78851 12 T Draw a ruler.
12 2 78851 12 X Draw a ruler.
14 2 79585 38 T Reposition plots
14 2 79585 38 X Reposition plots
15 2 81933 28 T Label a diagram
15 2 81933 28 X Label a diagram
16 2 83039 27 T Display a map.
16 2 83039 27 X Display a map.
7 1 84014 12 T Redirect output
7 1 84014 12 X Redirect output
13 2 84485 41 T Use crosshair
13 2 84485 41 X Use crosshair
33 2 86611 11 T Plot single contig
33 2 86611 11 X Plot single contig
34 2 87312 9 T Plot all contigs
34 2 87312 9 X Plot all contigs
31 3 87884 9 T Type in gel readings
31 3 87884 9 X Type in gel readings

1254
help/sip_help Normal file
View file

File diff suppressed because it is too large Load diff

78
help/sip_menu Normal file
View file

@ -0,0 +1,78 @@
-1 0 22 2 T General
-1 0 22 2 X General
-2 0 51 2 T Screen control
-2 0 72 2 X Screen
-3 0 101 2 T Set parameters
-3 0 101 2 X Set parameters
-4 0 126 2 T Comparison
-4 0 126 2 X Comparison
0 -1 144 208 T SIP
0 -1 144 208 X SIP
1 0 12690 39 T Help
1 0 12690 39 X Help
2 0 13755 3 T Quit
2 0 13755 3 X Quit
3 1 13828 220 T Read a new sequence
3 1 13828 220 X Read a new sequence
4 1 23656 10 T Define active region
4 1 23656 10 X Define active region
5 1 24191 16 T List a sequence
5 1 24191 16 X List a sequence
6 1 25001 4 T List a text file
6 1 25001 4 X List a text file
7 1 25143 12 T Direct output to disk
7 1 25143 12 X Direct output to disk
8 1 25627 4 T Write active region to disk
8 1 25627 4 X Write active region to disk
9 1 25764 5 T Edit the sequences
9 1 25764 5 X Edit the sequences
10 2 25944 3 T Clear graphics
10 2 25944 3 X Clear graphics
11 2 26021 3 T Clear text
11 2 26021 3 X Clear text
12 2 26089 15 T Draw a ruler
12 2 26089 15 X Draw a ruler
13 2 26869 54 T Use cross hair
13 2 26869 54 X Use cross hair
14 2 28754 29 T Reposition plots
14 2 28754 29 X Reposition plots
15 2 30429 13 T Label a diagram
15 2 30429 13 X Label a diagram
16 2 31213 7 T Display a map
16 2 31213 7 X Display a map
17 4 31596 19 T Apply identities algorithm
17 4 31596 19 X Apply identities algorithm
18 4 32260 81 T Apply proportional algorithm
18 4 32260 81 X Apply proportional algorithm
19 4 36686 42 T List matching spans
19 4 36686 42 X List matching spans
20 3 37569 16 T Set span length
20 3 37569 16 X Set span length
21 3 38560 13 T Set proportional score
21 3 38560 13 X Set proportional score
22 3 39251 6 T Set identities score
22 3 39251 6 X Set identities score
23 3 39544 79 T Calculate expected scores
23 3 39544 79 X Calculate expected scores
24 3 43148 90 T Calculate observed scores
24 3 43148 90 X Calculate observed scores
25 3 46152 26 T Show current parameter settings
25 3 46152 26 X Show current parameter settings
27 2 46802 5 T Draw a /
27 2 46802 5 X Draw a /
26 4 46991 57 T Quick scan
26 4 46991 57 X Quick scan
28 4 49883 90 T Align sequences
28 4 49883 90 X Align sequences
29 1 55133 4 T Complement the sequences
29 1 55133 4 X Complement the sequences
30 3 55256 9 T Switch main diagonal
30 3 55256 9 X Switch main diagonal
31 3 55755 8 T Switch identities
31 3 55755 8 X Switch identities
32 3 56202 17 T change score matrix
32 3 56202 17 X change score matrix
33 3 56884 16 T Set number of sd's for Quickscan
33 3 56884 16 X Set number of sd's for Quickscan
34 3 57767 13 T Set gap penalities
34 3 57767 13 X Set gap penalities

132
help/splitp_help Normal file
View file

@ -0,0 +1,132 @@
Preparing the PROSITE protein motif library for use by
the Staden programs
Introduction
A library of protein motifs (in our terminology, because
they include variable gaps, some would be called patterns) has
recently become available from Amos Bairoch,Departement de
Biochimie Medicale,University of Geneva Currently it contains 317
patterns/motifs and arrives on tape or cdrom in two files: a .dat
file and a .doc file. There is also a user documentation file
prosite.usr. Here I outline what is required to prepare the
PROSITE library for use by our programs.
Three programs need to be run SPLITP1, SPLITP2, and
SPLITP3.
Outline of the PROSITE files
A typical entry in the .dat file is shown below.
ID 2FE2S_FERREDOXIN; PATTERN.
AC PS00197;
DT APR-1990 (CREATED); APR-1990 (DATA UPDATE); APR-1990 (INFO UPDATE).
DE 2Fe-2S ferredoxins, iron-sulfur binding region signature.
PA C-x(1,2)-[STA]-x(2)-C-[STA]-{P}-C.
NR /RELEASE=14,15409;
NR /TOTAL=69(69); /POSITIVE=63(63); /UNKNOWN=0(0); /FALSE_POS=6(6);
NR /FALSE_NEG=5(5);
CC /TAXO-RANGE=A?EP?; /MAX-REPEAT=1;
CC /SITE=1,iron_sulfur; /SITE=5,iron_sulfur; /SITE=8,iron_sulfur;
DR P15788, FER$APHHA , T; P00250, FER$APHSA , T; P00223, FER$ARCLA , T;
DR P00227, FER$BRANA , T; P07838, FER$BRYMA , T; P13106, FER$BUMFI , T;
DR P00247, FER$CHLFR , T; P07839, FER$CHLRE , T; P00222, FER$COLES , T;
DO PDOC00175;
//
Each entry has an accession number (here PS00197), a
pattern definition (here C-x(1,2)-[STA]-x(2)-C-[STA]-{P}-C) and a
documentation file cross reference (here PDOC00175). This
pattern means: C, gap of 1 or 2, any of STA, gap of 2, C, any of
STA, not P, C.
We need to convert all of these patterns into our pattern
definitions (as membership of a set, with the appopriate gap
ranges) and write each into a separate pattern file with
corresponding "membership of a set" weight matrices. Each pattern
file is named accession_number.pat (here PS00197.PAT). The
corresponding matrix files are accession_number.wtsa,
accession_number.wtsb, etc for however many are needed (here
PS00197.WTSA and PS00197.WTSB): two are needed because of the
variable gap.
In addition we can optionally split the .dat and .doc
files into separate files, one for each entry, with names
accession_number.dat and accession_number.doc. Also we create an
index for the library prosite.lis, which gives a one line
description of each pattern, and ends with the pattern file and
documentation file numbers. The start of the file is shown below.
N-glycosylation site. 00001,00001
Glycosaminoglycan attachment site. 00002,00002
Tyrosine sulfatation site. 00003,00003
cAMP- and cGMP-dependent protein kinase phosphorylation site. 00004,00004
So the name of the pattern file for Glycosaminoglycan attachment
site is PS00002.PAT, and for the documentation file PDOC00002.DOC
Finally we create a file of file names for all the
patterns in the library.
To use the complete PROSITE library from program pip,
select "pattern searcher" and choose the option "use file of
pattern file names", and give the file name prosite.nam). For any
matches found, the accession number and pattern title will be
displayed.
Running the conversion programs
Only SPLITP3 is necessary for using the library. The
others programs only make the original files marginally easier to
browse through and produce an index.
SPLITP1 splits the prosite.dat file to create a separate
file for each entry. Each file is automatically named
PSentry_number.dat. In addition it creates an index for the
library (see above).
SPLITP2 performs the same operation for the Prosite.doc
file, except that no index is created. Files are named
PSentry_number.doc.
SPLITP3 creates a separate pattern file and weight matrix
files for each prosite entry from the file prosite.dat. Pattern
files are named PSentry_number.pat, weight matrix files
PSentry_number.wtsa, Psentry_number.wtsb, etc. The pattern title
is the one line description of the motif. SPLITP3 also creates a
file of file names. Notice that it will ask for a path name so
that the path can be included in the file of file names. This is
the path to the directory in which the pattern files are stored.
Notes
Obviously the use of files of file names is a general
solution, and anybody could now create their own set of
interesting patterns for screening, or a subset of prosite.nam,
etc.
Note that 5 of the bairoch motifs contained the symbols >
or < which means that the motifs must appear exactly at the N or
C termini of the sequences. Currently our methods have no
mechanism for such definitions and, for example KDEL motifs, will
be permitted to occur anywhere throughout a sequence.
Also, of course, the library does not have to be used
solely for performing mass screenings: each individual entry can
be used as a single pattern by giving the name of its .pat file -
eg pathname/ps00002.pat In addition more sophisticated users will
wish to copy pattern files and weight matrices into their own
directories and modify them. For example the cutoff scores are
probably chosen to be quite high in order to reduce the number of
false positives, and some users might wish to lower them.

81
help/staden.references Normal file
View file

@ -0,0 +1,81 @@
References with further information about the methods
Staden, R. Nucl. Acid Res. 8, 817-825 (1980)
A computer program to search for tRNA genes. (NIP)
Staden, R. Nucl. Acid Res. 8, 3673-3694 (1980)
A new computer method for the storage and manipulation
of DNA gel reading data. (SAP).
Staden, R. Nucl. Acid Res. 10, 2951-2961 (1982)
An interactive graphics program for comparing and
aligning nucleic acid and amino acid sequences.
(SIP).
Staden, R. Nucl. Acid Res. 10, 4731-4751 (1982)
Automation of the computer handling of gel reading data
produced by the shotgun method of DNA sequencing.(SAP)
Staden, R. and McLachlan, A.,D. Nucl. Acid Res. 10
141-156 (1982)
Codon preference and its use in identifying protein
coding regions in long DNA sequences. (NIP)
Staden, R. Nucl. Acid Res. 12, 499-503 (1984)
A computer program to enter DNA gel reading data into a
computer. (GIP)
Staden, R. Nucl. Acid Res. 12, 551-567 (1984)
Measurements of the effects that coding for a protein
has on on a DNA sequence and their use for finding
genes. (NIP: positional base preferences, uneven
positional base frequencies)
Staden, R. Nucl. Acid Res. 12, 505-519 (1984)
Computer methods to locate signals in nucleic acid
sequences. NIP: promoters, ribosome binding
sites, intron/exon junctions.
McLachlan A D, Staden R and Boswell D R, Nucl. Acid Res.
12, 9567-9575 (1984)
Measure of strength of codon preference. (NIP)
Staden R, Computer methods to locate genes and signals in
nucleic acid sequences, Genetic Engineering: Principles
and Methods Vol. 7, Edited by J. K. Setlow and A.
Hollaender, Plenum Publishing Corp. 1985. (NIP)
Staden R Nucl. Acid. Res. 14, 217-231 (1986)
The current status and portability of our sequence
handling software. Summary for May 1985.
Staden R "Computer Handling of DNA sequencing projects" in
Nucleic acid and protein sequence analysis, A practical
approach, 173-217. Edited by M.J.Bishop and C.J.Rawlings,
IRL press (1987). (SAP)
Staden R, Methods to define and locate patterns of motifs in
sequences. CABIOS 4 53-60 (1988). (NIP, PIP,
NIPL, PIPL)
Staden R, Methods for calculating the probabilities of finding
patterns in sequences. CABIOS 5 89-96 (1989). (NIP, PIP,
NIPL, PIPL)
Staden R, "Methods for discovering novel motifs in nucleic acid
sequences". CABIOS 5, 293-298, (1989). (MEP)
Staden R, Methods to search for patterns in protein and nucleic
acid sequences. In Doolittle, R,R (ed), Methods in
Enzymology, 183, Academic Press, San Diego, CA, 193-211.
(1990) (NIP, NIPL, PIP, PIPL)
Staden R, Finding protein coding regions in genomic sequences.
In Doolittle, R,R (ed), Methods in Enzymology, 183,
Academic Press, San Diego, CA, 163-180. (1990) (NIP)
Gleeson T J and Staden R, An X windows and UNIX implementation
of our sequence analysis package. CABIOS 7 398 (1991)
Staden R, Screening protein and nucleic acid sequences against
libraries of patterns. DNA Sequence, in press (NIP, PIP,
SPLITP1, SPLITP2, SPLITP3, PROSITE)
Dear S and Staden R, A sequence assembly and editing program for
efficient management of large projects. Nucleic Acids
Research 19 3907-3911 (1991) (XDAP)
Staden R and Dear S, Indexing the sequence libraries: Software
providing a common indexing system for all the standard
sequence libraries. DNA Sequence 3, 99-105 (1992).
Dear S and Staden R, A standard file format for data from DNA
sequencing instruments. DNA Sequence 3, 107-110 (1992)
Gleeson T and Hillier L, A trace display and editing program
for data from fluorescence based sequencing machines.
Nucleic Acids Research 19 6481-6483 (1991) (TED)
Staden R, Staden package update. Genome News 13 12-13 (1993)

184
help/staden_help Normal file
View file

@ -0,0 +1,184 @@
Introduction to the Staden sequence analysis package and its
user interface
The package contains the following programs:
GIP Gel input program
SAP Sequence assemble program
NIP Nucleotide interpretation program
PIP Protein interpretation program
SIP Similarity investigation program
MEP Motif exploration program
NIPL Nucleotide interpretation program (library)
PIPL Protein interpretation program (library)
SIPL Similarity investigation program (library)
GIP uses a digitiser for entry of DNA sequences from
autoradiographs.
SAP handles everything relating to assembling gel readings in order
to produce a consensus sequence. It can also deal with families of
protein sequences.
NIP provides functions for analysing and interpretting individual
nucleotide sequences.
PIP provides functions for analysing and interpretting individual
protein sequences.
MEP analyses families of nucleotide sequences to help discover new
motifs.
NIPL performs pattern searches on nucleotide sequence libraries.
PIPL performs pattern searches on protein sequence libraries.
SIP provides functions for comparing and aligning pairs of protein
or nucleotide sequences.
SIPL searches nucleotide and protein sequence libraries for entries
similar to probe sequences.
Documentation
As is explained below, the programs SAP, NIP, PIP, SIP and MEP
have online help, and the help files have the names: HELPSAP,
HELPNIP, HELPPIP, HELPSIP, HELPMEP. These files can be displayed on
the screen or printed using the appropriate commands. Currently the
help for the other programs is also contained in these files. For
example help for NIPL is in HELPNIP. This file is called HELPSTADEN.
Sequence formats
The shotgun sequencing program SAP deals only with simple text
files for gel readings, and is a self-contained system. However as
there is still no single agreed format for finished sequences or for
libraries of sequences, the other programs in the package can read
data that is stored in several ways.
The analytical programs can read individual sequences stored
in the following formats: Staden, EMBL, Genbank, PIR (also known as
NBRF), and GCG, but for storing whole libraries we use only PIR
format. In addition these programs can perform a number of simple
operations using libraries stored in this format. They can extract
entries by entry name, can search titles for keywords, can search
the whole of the annotation files for keywords, and can extract
annotations for any named entry. We reformat all sequence libraries
into PIR format. Currently we have NBRF, EMBL, SWISSPROT and VECBASE
libraries in PIR format.
The library searching programs operate only on sequences
stored in PIR format.
The analytical programs will operate with uppercase or
lowercase sequence characters. In addition T and U are equivalent.
SAP uses uppercase letters for original gel readings and lowercase
letters for characters that are corrected by the automatic editor.
Programs NIP and PIP use IUB symbols for redundancy in back
translations and for sequence searches. The symbols are shown
below.
NC-IUB SYMBOLS
A,C,G,T
R (A,G) 'puRine'
Y (T,C) 'pYrimidine'
W (A,T) 'Weak'
S (C,G) 'Strong'
M (A,C) 'aMino'
K (G,T) 'Keto'
H (A,T,C) 'not G'
B (G,C,T) 'not A'
V (G,A,C) 'not T'
D (G,A,T) 'not C'
N (G,A,C,T) 'aNy'
The user interface
The user interface is common to all programs. It consists of a
set of menus and a uniform way of presenting choices and obtaining
input from the user. This section describes: the menu system; how
options are selected and other choices made; how values are
supplied to the program; how help is obtained, and how to escape
from any part of a program. In addition it gives information about
saving results in files and the use of graphics for presenting
results.
Menus
Each program has several menus and numerous options. Each menu
or option has a unique number that is used to identify it. Menu
numbers are distinguished from option numbers by being preceded by
the letter m (or M, all programs make no distinction between upper
and lower case letters). With the exception of some parts of program
SAP, the menus are not hierachical, rather the options they each
contain are simply lists of related functions and their identifying
numbers. Therefore options can be selected independently of the menu
that is currently being shown on the screen, and the menus are
simply memory aides. All options and menus are selected by typing
their option number when the programs present the prompt
"? Menu or option number =".
To select a menu type its number preceded by the letter M. To
select an option type its number. If you type only "return" you
will get menu m0 which is simply a list of menus. If you select an
option you will return to the current menu after the function is
completed.
When you select an option, in many cases the program will
immediately perform the operation selected without further dialogue.
If you precede an option number by the letter d (e.g. D17), you will
force the program to offer dialogue about the selected option before
the function operates, hence allowing you to change the value of any
of its parameters. If you precede an option number by the symbol ?
(e.g. ?17), you will be given help on the option (here 17).
Where possible, equivalent or identical options have been
given the same numbers in all programs, and so users quickly learn
the numbers for the functions they employ most often.
Help
As mentioned above, help about each option can be obtained by
preceding the option number by the symbol ? when you are presented
with the prompt "? Menu or option number", but there are two further
ways of obtaining help. Whenever the program asks a question you can
respond by typing the symbol ? and you will receive information
about the current option. In addition, option number 1 in all the
programs will give help on all of a programs functions.
Quitting
To exit from any point in a program you type ! for quit. If a
menu is on the screen this will stop the program, otherwise you will
be returned to the last menu.
Other interactions
Questions are presented in a few restricted ways. In all
cases typing only "return" in response to a question means yes, and
typing N or n means no.
Obvious opposites such as "clear screen" and "keep picture"
are presented with only the default shown. For example in this case
the default is generally "keep picture" so the program will display:
"(y/n) (y) Keep picture"
and the picture will be retained if the user types anything
other than N or n, (in which case the screen will be cleared).
Where there are choices that are not obvious opposites, or
there are more than two choices, two further conventions are used:
"radio buttons" and "check boxes".
Radio buttons are used when only one of a number of choices
can be made at any one time. The choices are presented arranged one
above the other, each choice with a number for its selection, and
the default choice marked with an X. For example in the restriction
enzyme search routine the following choices are offered:
Select output mode
1 order results enzyme by enzyme
2 order results by positon
X 3 show only infrequent cutters
4 show names above the sequence

26
help/stadenp_help Normal file
View file

@ -0,0 +1,26 @@
Standard Staden Programs
gip Gel input program
sap Sequence assembly program
(x)dap Sequence assembly program
(x)nip Nucleotide interpretation program
(x)pip Protein interpretation program
(x)sip Similarity investigation program
(x)mep Motif exploration program
nipl Nucleotide interpretation program (library)
pipl Protein interpretation program (library)
sipl Similarity investigation program (library)
Those with (x) have both tektronix (say nip) and x (say xnip) versions.
Environment variables for help files
HELPSAP sap
HELPDAP dap
HELPGIP gip
HELPNIP nip
HELPPIP pip
HELPSIP sip
HELPMEP mep
HELPSTADEN Introduction and user interface
e.g. to read HELPSTADEN type 'more $HELPSTADEN'

168
help/ted.help Normal file
View file

@ -0,0 +1,168 @@
Trace Editor Help
-----------------
The ted trace editor is a prototype to allow the display and editing
of traces from sequencing machines, and the simple editing of plain
sequences. It runs under the X window system. It provides simultaneous
display of traces and bases. The editing allows individual bases to be
removed and new ones added, and also a range of bases at either end to
be cutoff. Currently, only ABI result files and plain sequences are
accepted.
Only one trace can be edited at a time.
Invocation
----------
ted can be run from the command line by simply typing:
ted
It will come up with no sequence initially displayed. If provided with
any arguments it does not understand, or invalid combinations of
arguments, ted will exit with a message indicating its intended usage.
ted accepts the standard X arguments allowing, for example, background
colour or geometry to be specified. ted can accept an argument
specifying an initial file to display. The key for this is the format
of the file, for example:
ted -ABI {ABI format filename}
ted -plain {plain format filename}
The file is then displayed at 50% magnification, with the caret
initially positioned at the first base.
When an initial file is given, a base number of interest and/or a
magnification can also be given, for example:
ted -ABI {ABI format file} -baseNum 280 -mag 30
or the bottom strand may be specified:
ted -ABI {ABI format file} -baseNum 280 -mag 30 -bottom 1
or
ted -ABI {ABI format file} -bottom 1
or a string of nucleotides on which the center the window:
ted -ABI {ABI format file} -astring 1
or
ted -ABI {ABI format file} -astring 1 -mag 30 -bottom 1
Options can be specified in any order.
An output filename can be specified in a similar manner:
ted -ABI inputfilename -output outputfilename
The default output filename is inputfilename.seq
If you are running the program on a remote machine, you must
specify a display parameter:
ted -display machine_name:0.2
You can also specify the size of the opening window or
other screen parameters by the following:
ted -geometry [{width}][x{height}][{+-}{xoff}[{+-}{yoff}]]
[-fg {color}] [-bg {color}] [-bd {color}] [-bw {pixels}]
Displays
--------
When running, ted displays the name of the file it is currently
operating on (if any) and the original number of bases.
A so-called viewport presents four different synchronised views of
part of the trace. The top one indicates the sequence indices - the
first digit of the number if positioned over the base to which that
number corresponds. Below this is a list of the bases as originally
found in the file (this is the interpretation of the trace as made by
the sequencing machine). Below this is the list of bases as edited by
the user --- initially, if this file has not been edited in the past,
this is identical to the list of original bases. However, if in a
previous session the user has edited this sequence, the edited
version of the sequence will appear in the edit window.
The final display is of the traces produced by the sequencing
machine for the four respective bases.
Two controls allow the view presented to be adjusted: both are
horizontal sliders or scrollbars. The first affects the magnification
at which the trace is viewed. The minimum magnification is such that
the whole of the trace is visible within the viewport; when a trace is
first input, this is the magnification used. The maximum magnification
is such that bases are spaced out with several characters of space
between them --- this should allow more than enough room for base
insertions to be clearly visible. The second scrollbar is immediately
above the viewport and allows the user to select which part of the
trace is viewed. Both the sliders work in a similar way: the middle
mouse button can be used to drag the thumb to any desired position,
the left and right mouse buttons can be clicked within the scrollbar
to indicate that paging up or down is desired. In the case of the
viewport scrollbar, the amount of paging is determined by how far up
the scrollbar the pointer is.
The whole ted window can be expanded and contracted (to an extent) by
dragging the "grow-region" provided by whatever window manager is
running. The viewport takes up all of this change in size.
Controls
--------
ted has four buttons. "Quit" exits the program after first checking
whether there is a sequence which has been edited and not saved.
"Help" pops up this window which has a scrollbar on the left allowing
all the text to be viewed.
"Input" presents a dialogue which asks for the format and name of a
file to be processed. The bases and (if this is not a plain format
file) traces are read in and displayed for editing. The only
conversion performed on bases is from 'N' to '-'.
"Output" presents a dialogue which asks for a filename into which the
edited and clipped bases can be saved. The default value can be set
on the command line using the "-output" keyword. No conversion of bases
is performed on output.
ted operates in one of three editing modes, one of which is selected
from three "radio buttons". The currently selected mode is
highlighted.
Editing
-------
In "Edit sequence" mode, the (lower) list of editable bases can be
edited in much the same way as a text editor operates. A "caret" which
is visible in the display of edited bases can be moved left and right
with the cursor keys (these are sometimes called arrow keys and often
appear on numeric keypads). It can also be positioned by clicking any
button while the pointer is pointing into either of the list of bases
or the traces. The DELETE key deletes the base immediately to the left
of the caret. Any printing character can be inserted to the right of
the caret by simply typing it. Inserted characters are placed halfway
between their neighbours, or if a space is left by the deletion of a
base originally there, its position is used. A base can thus be
changed by deleting it and entering the new base.
Note that in the current version of ted the caret is not constrained
to remain within the viewed part of the display and that editing can
still continue while it is thus invisible. Such editing would probably
only occur by accident.
ted provides a facility to define a cutoff at either end of the trace.
A number of the leftmost bases (corresponding to the vector) and the
rightmost bases (corresponding to the point where the data become
unreliable) can be defined by setting the editor into "Adjust left
cutoff" or "Adjust right cutoff" mode. In either of these modes, the
pointer and mouse buttons can be used to indicate the cutoff point,
and the cursor keys can be used to adjust this leftwards or
rightwards. Initially, the cutoff regions are both empty. The cutoff
regions are clearly indicated on the list of edited bases display and
on the traces display by being drawn with a dimmed background.
When the sequence is written out, the list of edited bases, with both
cutoff regions removed, is written. The output contains newlines
for convenient formatting and always ends with one.

102
manl/staden.l Normal file
View file

@ -0,0 +1,102 @@
.TH staden 1L "November 1991" "MRC LMB" "LOCAL"
.SH NAME
staden, xstaden \- sequence analysis suite
.SH DESCRIPTION
.I staden
is a suite of programs for sequence analysis. Currently available are
.I mep,
.I nip,
.I pip,
.I sap,
.I sip,
.I nipl,
.I pipl,
.I and sipl.
These all run under the SUN X11
.I xterm
Tektronics terminal emulator, but also work with the VT640 terminal
and the VersaTermPro and MS-Kermit emulators if they login to a SUN.
.PP
.I xstaden
is the same set of programs, named
.I xmep,
.I xnip,
.I xpip,
.I xsap,
.I xdap,
and
.I xsip,
which run directly under X providing a convenient user interface,
including resizable output and pull-down menus. All these programs
accept the standard X arguments. The library searching programs
nipl, pipl and sipl are only available in xterm form.
.PP
Sequence library access is provided for the format as distributed
on CDROM by EMBL. The CDROM contains the EMBL nucleotide library and
the SWISSPROT protein library. The libraries can be left on the
CDROM or transferred to hard disk.
.PP
The programs also provide an interface to the PROSITE protein motif
library.
.PP
Some initialisation is required in order to use the package. csh users
should insert the following in their .login files:
.IP
setenv STADENROOT /home/BioSW/staden
.IP
source $STADENROOT/staden.login
.LP
Users of the Bourne shell, sh, should insert the following in
their .profile:
.IP
STADENROOT=/home/BioSW/staden
.IP
export STADENROOT
.IP
. $STADENROOT/staden.profile
.LP
These initialisations will alter your shell's search path so
that it can find the program binaries, and other files that are
required.
.SH ENVIRONMENT
The following environment variables may be set in the
user's \fI .login\fP or \fI .profile\fP file:
.TP 20
.BI STADENROOT= /home/BioSW/staden
This must be set in the user's initialisation.
.TP 20
.BI SEQEDT= editor
Set the editor to be used by the package. The default is
\fIemacs\fP.
.SH FILES
.PD 0
.TP 30
$STADENROOT/staden.login
csh initialisation
.TP 30
$STADENROOT/staden.profile
sh initialisation
.TP 30
$STADENROOT/tables
Tables used by the programs
.TP 30
$STADENROOT/help
Helpfiles used by the programs, documentation of the user interface
and of each of the programs.
.TP 30
$STADENROOT/tables/SEQUENCELIBRARIES
Defines the sequence libraries available, their file descriptors
and the prompts to appear on the users screen.
.SH AUTHOR
Rodger Staden, MRC Laboratory of Molecular Biology, Hills Rd., Cambridge,
CB2 2QH, UK.
.SH BUGS
.PP
When using the xterm programs and in graphics input mode,
a carriage return should not be
entered on its own but should be preceded by some other character,
such as SPACE, COMMA or K. If a carriage return is entered on its
own, some garbage will (relatively) harmelssly appear on the plot.
.PP
General comments on the package can be sent to
\fI<rs@uk.ac.cam.mrc-lmb>\fP

107
manl/ted.l Normal file
View file

@ -0,0 +1,107 @@
.TH ted 1L "July 1991" "MRC LMB" "LOCAL"
.SH NAME
ted \- trace editor
.SH SYNOPSIS
.B ted
[(
.B -ABI\||\|-ALF\||\|-plain
)
.I tracefilename
[
.B -baseNum
.I number
]
.B [
.B -mag
.I number
( 1 to 100 )
]
.B [
.B -bottom
.I number
(1(true) or 0(false))
.B ]
.B [
.B -astring
.I nucleotide-string
]]
.B [
.B -enzyme
.I 5' cutting sequence
]
.B [
.B -raw
.I filename
(to be placed at head of xdap compatible .seq file)
.B ]
[
.B -output
.I outputfilename
]
.SH DESCRIPTION
.B ted
is a simple prototype editor for traces produced from automatic
sequencing machines. It allows the traces (from the ABI
or ALF sequencing machines) produced to be
displayed along with the machines interpretation of these into
bases and an initially identical sequence which can be edited
by the user. A cutoff region can be defined at both ends. The
edited and clipped list of bases can then be written out.
.LP
When initially run,
.B ted
displays the trace file
.I tracefilename
(if given) of the specified format centered on the base number
.I baseNum
(if given). If no file is provided,
.B ted
initially displays nothing.
.LP
The display consists of
the control panel and the synchronized view of the base position
information, original and edited sequence data,
and graphical representation of the trace (with each nucleotide's trace
being represented by a different color). The control
panel allows the user to read in new trace files (in either
bottom or top strand orientation)
as well as to search for a string of nucleotides or a certain base position.
The information button brings up signal strength and average spacing for
ABI files.
Scroll bars allow the user to adjust the magnification of or scroll through
the sequence and trace data. The user may also choose to change the vertical
magnification of the trace data. Further, sequence on the head (vector)
or tail (uncertain data) of the sequence may be ``cutoff''
using the adjust left and right cutoff buttons. Bases can be inserted,
deleted, or replaced as with
any ordinary word-processor in the sequence data window. Finally, the
sequence may be written to an ascii file using the output button on
the control panel. The output filename is specified in a dialogue,
but a default value of inputfilename.seq is provided or the default value
can be given with the
.I outputfilename
argument.
.LP
A simple help system is provided.
.SH FILES
.PD 0
.TP 20
.B ted.help
Text provided in the help window.
.TP
.B /usr/lib/X11/app-defaults/Xted
Default application resources.
.SH ENVIRONMENT
.TP 20
.SB XFILESEARCHPATH
Specifies the locations where
.B ted.help
is sought.
If this is not defined,
.B ted.help
must be in the
.B /usr/lib/X11/app-defaults
directory.
.SH AUTHORS
Tim Gleeson, LaDeana Hillier, Simon Dear.

7
src/Misc/README Normal file
View file

@ -0,0 +1,7 @@
Miscellaneous Routines Simon Dear, 14 April 1992
---------------------------------------------------------------
The source modules in this directory are for commonly used
routines. The archive misc.a should be made before any
other programs supplied on this tape.

15
src/Misc/crash.c Normal file
View file

@ -0,0 +1,15 @@
#include "misc.h"
#include <stdio.h>
#include <stdlib.h>
#include <stdarg.h> /* varargs needed for v*printf() prototypes */
void crash (char* format,...)
{
va_list args ;
va_start (args,format) ;
vfprintf (stderr,format,args) ;
va_end (args) ;
exit (1) ;
}

14
src/Misc/date.c Normal file
View file

@ -0,0 +1,14 @@
#include "misc.h"
#include <stdio.h>
/******************************************************************************/
/*
** Time and date calculations
*/
#include <time.h>
char *date_str()
{
time_t clock;
clock = time(NULL);
return ctime(&clock);
}

39
src/Misc/filenames.c Normal file
View file

@ -0,0 +1,39 @@
#include "misc.h"
#include <string.h>
char *fn_tail(char *fn)
/*
** Return file part (:t) of
** directory path
*/
{
int len;
char *s;
len = strlen(fn);
for(s=fn+len-1;len && *s != '/'; len--, s--) ;
s++;
return s;
}
void fn_toupper (char *s)
/*
** Convert file to upper case
** ignoring directory path head
*/
{
str_toupper(fn_tail(s));
}
void fn_tolower (char *s)
/*
** Convert file to lower case
** ignoring directory path head
*/
{
str_tolower(fn_tail(s));
}

41
src/Misc/files.c Normal file
View file

@ -0,0 +1,41 @@
#include "misc.h"
#include <sys/types.h>
#include <sys/stat.h>
/* Alliant's Concentrix <sys/stat.h> is hugely deficient */
/* Define things we require in this program */
/* Methinks S_IFMT and S_IFDIR aren't defined in POSIX */
#ifndef S_ISDIR
#define S_ISDIR(m) (((m)&S_IFMT) == S_IFDIR)
#endif /*!S_ISDIR*/
#ifndef S_ISREG
#define S_ISREG(m) (((m)&S_IFMT) == S_IFREG)
#endif /*!S_ISREG*/
int is_directory(char * fn)
{
struct stat buf;
if ( stat(fn,&buf) ) return 0;
return S_ISDIR(buf.st_mode);
}
int is_file(char * fn)
{
struct stat buf;
if ( stat(fn,&buf) ) return 0;
return S_ISREG(buf.st_mode);
}
int file_exists(char * fn)
{
struct stat buf;
return ( stat(fn,&buf) == 0);
}
int file_size(char * fn)
{
struct stat buf;
if ( stat(fn,&buf) != 0) return 0;
return buf.st_size;
}

39
src/Misc/find.c Normal file
View file

@ -0,0 +1,39 @@
#include "misc.h"
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
char *myfind(char *file, char* searchpath, int (*found) (char *) )
{
static char wholePath[1024];
char *path;
char *delimiters=":";
char *f;
f = NULL;
if (found(file)) {
strcpy(wholePath,file);
f = wholePath;
} else if (searchpath != NULL) {
char *paths;
paths = (char *) malloc(strlen(searchpath)+1);
strcpy(paths,searchpath);
path = (char *) strtok(paths,delimiters);
while (path!= NULL) {
(void) strcpy(wholePath,path);
(void) strcat(wholePath,"/");
(void) strcat(wholePath,file);
if (found(wholePath)) {
f = wholePath;
break;
}
path = (char *) strtok((char *)NULL,delimiters);
}
free(paths);
}
return f;;
}

Some files were not shown because too many files have changed in this diff Show more