staden-lg/src/bap/llin.h

63 lines
2.3 KiB
C

/* A PACKAGE FOR SEQUENCE COMPARISON WITH AFFINE WEIGHTS:
Gene Myers, Dept. of Computer Science, U. of Arizona 85721 (10/3/87)
#define NMAX <integer>
NMAX is a compilation constant giving the maximum input sequence length.
It is to be adjusted according to available memory.
int DIFF(A,B,M,N,W,G,H,S) int M,N; char A[],B[]; int W[][128],G,H; int S[];
DIFF compares sequence A[1..M] with sequence B[1..N] and returns the
minimum conversion cost. Costs are determined by the parameters W, G,
and H. W[128][128] is an array giving replacement costs for each pair of
ASCII characters, e.g. W['a']['b'] is the cost of replacing 'a' by 'b'.
Be sure to set W['a']['a'] to zero if exact matches are to accrue no cost.
The cost of a k-symbol indel is the affine function G+Hk.
DIFF also has the side-effect of placing an encoding of an optimal
conversion in an integer array S[0..M+N-1] supplied by the caller.
The sequence of integers S[0], S[1], S[2], ... gives the editing
operations in a left-to-right conversion where integers encode
operations as follows:
0 => replace
-k => delete k symbols
+k => insert k symbols.
The script is guaranteed to have the properties:
(1) Inserts are never followed by inserts.
(2) Deletes are never followed by deletes or inserts.
(3) A replacement followed by a k-gap is always preferred
to a k-gap followed by a replacement in the event that
both have the same cost.
DIFF returns -1.0 if NMAX isn't large enough.
int DISPLAY(A,B,M,N,S) int M,N; char A[],B[]; int S[];
DISPLAY places on the standard output a display of the alignment
implied by the conversion S computed in the call DIFF(A,B,M,N,?,?,?,S).
For example:
0 . : . : . : . : . :
ggcgtttcataccggcgagga ctagagatcccagatgcagcctcgata
!-!!!!||||!!!!!!!!!!|--!!!!!|!!|!!||||!!-!!!!!!!!!
g cgttcataaccggcgaggtacctagacattcccagagc gcctcgata
50 . : . : .
taggaagaa tc agcaacgatcggcatg
!|!||!!!!-!!-!!!!!!!!-!!|!-!!
tggacagaaatcgagcaacga cgac tg
*/
#ifdef BIGMEM
#define NMAX 30000
#else
#define NMAX 3000
#endif
extern int DIFF();
extern int DISPLAY();