297 lines
10 KiB
Text
297 lines
10 KiB
Text
|
General Information
|
||
|
(Not for the faint hearted)
|
||
|
|
||
|
30 September 1992
|
||
|
|
||
|
|
||
|
0. Introduction
|
||
|
---------------
|
||
|
|
||
|
This document contains information on the following subjects:
|
||
|
|
||
|
1. Installing the Staden Package on SPARCstations and DECstations
|
||
|
2. Installing the Staden Package on Other Machines
|
||
|
3. A Quick Guide to What's on the Release Tape
|
||
|
4. Overview of Data Flow During Sequence Assembly
|
||
|
5. Acknowledgements
|
||
|
|
||
|
|
||
|
|
||
|
1. Installing the Staden Package on SPARCstations and DECstations
|
||
|
-----------------------------------------------------------------
|
||
|
|
||
|
We are endeavouring to make the installation of the Staden Package as
|
||
|
quick and as easy as possible. In this current release we provide
|
||
|
statically linked sparc and mips executables as well as all sources.
|
||
|
|
||
|
To install the package:
|
||
|
|
||
|
1) Create a new directory for the software. You may have to log on as
|
||
|
superuser to do this.
|
||
|
|
||
|
% mkdir -p /home/BioSW/staden
|
||
|
|
||
|
2) Place the distribution tape in the drive and down load the package:
|
||
|
|
||
|
-sun-
|
||
|
% tar xvf /dev/rst0
|
||
|
...system messages...
|
||
|
|
||
|
-dec-
|
||
|
% tar xvf /dev/rmt0h
|
||
|
...system messages...
|
||
|
|
||
|
3) Users of the C Shell should add the following to his/her .login
|
||
|
file:
|
||
|
|
||
|
setenv STADENROOT /home/BioSW/staden
|
||
|
source $STADENROOT/staden.login
|
||
|
|
||
|
Users of the Bourne shell should add the following to their .profile
|
||
|
file:
|
||
|
|
||
|
STADENROOT=/home/BioSW/staden
|
||
|
export STADENROOT
|
||
|
. $STADENROOT/staden.profile
|
||
|
|
||
|
|
||
|
4) When the user next logs onto the work station the required
|
||
|
initialisation will automatically be performed, and the programs in
|
||
|
the Staden package can be run. Refer to the help/*.MEM files for
|
||
|
information on the various program. (eg help on xdap is in
|
||
|
help/DAP.MEM)
|
||
|
|
||
|
|
||
|
2. Installing the Staden Package on Other Machines
|
||
|
--------------------------------------------------
|
||
|
|
||
|
This is a little more difficult as you will need to remake all the
|
||
|
executables. Your system configuration may also mean that some changes
|
||
|
will need to be made, though hopefully only to makefiles. We provide
|
||
|
a script to aid installation (we hope!), but you may prefer to make
|
||
|
all the components manually.
|
||
|
|
||
|
To remake the Staden package you will require the following:
|
||
|
1) A Fortran77 compiler
|
||
|
2) An ANSI C compiler
|
||
|
3) X11 Release 4, including the Athena Widget libraries.
|
||
|
|
||
|
Start by following step 1 through 3 above, to unload the sources and
|
||
|
perform initialisations. Read the rest of this document and the other
|
||
|
help files. Look at the make files. Follow your nose!
|
||
|
|
||
|
If you have any problems or successes porting our software to other
|
||
|
platforms we would love to hear from you. We would also appreciate
|
||
|
receiving your general comments on the package.
|
||
|
|
||
|
Rodger Staden (principle author)
|
||
|
phone: +44 223 402389 email: rs@mrc-lmba.cam.ac.uk
|
||
|
post: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, U.K.
|
||
|
Simon Dear:
|
||
|
phone: +44 223 402266 email: sd@mrc-lmba.cam.ac.uk
|
||
|
post: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, U.K.
|
||
|
James Bonfield:
|
||
|
phome: +44 223 402499 email: jkb@mrc-lmba.cam.ac.uk
|
||
|
post: MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, U.K.
|
||
|
|
||
|
|
||
|
|
||
|
3. A Quick Guide to What's on the Release Tape
|
||
|
----------------------------------------------
|
||
|
|
||
|
The directory structure on this tape is very important. Once set up, the Staden
|
||
|
package expects things to be in a predefined place. The root directory
|
||
|
of the structure is referred to by the environment variable
|
||
|
STADENROOT. Below this there should be at least the following:
|
||
|
|
||
|
1) bin/
|
||
|
All executable files and scripts should be in this directory.
|
||
|
$STADENROOT/bin is added to the search path by the script staden.login
|
||
|
(or staden.profile if you are using the Bourne Shell). Though you are
|
||
|
not forced to keep programs here, we find it is the simplest place to
|
||
|
keep them.
|
||
|
|
||
|
2) help/
|
||
|
All on-line help files are in this directory. Files of the form *.MEM
|
||
|
or *.mem are formatted ascii files and can be printed for personal
|
||
|
reference. The script staden.login sets up many environment variables
|
||
|
that refer to files in this directory, as well as modifying
|
||
|
XFILESEARCHPATH, which is used by X programs.
|
||
|
|
||
|
3) manl/
|
||
|
Local manual pages for ted and the staden package are in this directory. The
|
||
|
environment variable MANPATH is modified in staden.login to search
|
||
|
here too.
|
||
|
|
||
|
4) staden.login and staden.profile
|
||
|
These two files are scripts to set up environment variables required
|
||
|
by the Staden package. C Shell users should source staden.login from
|
||
|
their .login file, and Bourne Shell users should "source" staden.profile
|
||
|
from their .profile directory. See "Installing the Staden Package on
|
||
|
SPARCstations and DECstations", Part 3.
|
||
|
|
||
|
5) tables/
|
||
|
Configuration files for the Staden package are in this directory.
|
||
|
Various environment variables are set in staden.login to refer to
|
||
|
files in this directory.
|
||
|
|
||
|
Also of use are the following:
|
||
|
|
||
|
doc/ - Miscellaneous documentation.
|
||
|
userdata/ - Sample databases
|
||
|
src/ - program sources
|
||
|
ReleaseNotes - Notes on this and future releases
|
||
|
Staden_install - Installation script
|
||
|
SequenceLibraries - Notes on the use and installation of sequence libraries
|
||
|
|
||
|
|
||
|
Program Sources
|
||
|
---------------
|
||
|
|
||
|
All the program sources are found in the directories in $STADENROOT/src:
|
||
|
|
||
|
0) Misc/
|
||
|
Sources for a library of useful routines used by the staden package.
|
||
|
** Should be made before the programs in staden/ **
|
||
|
|
||
|
1) staden/
|
||
|
Sources for the Staden suite: mep, xmep, nip, xnip, nipl, pip, xpip,
|
||
|
pipl, sap (now superseded by dap), xsap (now superceded by xdap), sip,
|
||
|
xsip, sipl, dap, xdap, splitp1, splitp2, splitp3, gip and convert_project.
|
||
|
|
||
|
2) ted/
|
||
|
Sources for the trace display and sequence editing program ted.
|
||
|
|
||
|
3) abi/
|
||
|
Sample scripts and programs for handling ABI 373A data files.
|
||
|
|
||
|
4) alf/
|
||
|
Sample scripts and programs for handling Pharmacia A.L.F. data files.
|
||
|
|
||
|
Each directory has appropriate makefiles and README files.
|
||
|
|
||
|
|
||
|
|
||
|
4. Overview of Data Flow During Sequence Assembly
|
||
|
-------------------------------------------------
|
||
|
|
||
|
During a sequence assembly project the data can enter the sequence
|
||
|
assembly program from various routes (See Figure below).
|
||
|
|
||
|
|
||
|
|
||
|
Fluorescent Based
|
||
|
Sequencing Machine
|
||
|
Chromatogram Autoradiogram
|
||
|
|
||
|
ABI 373A Pharmacia A.L.F. |
|
||
|
| | |
|
||
|
| | |
|
||
|
| alfsplit |
|
||
|
| | |
|
||
|
+--------+--------+ |
|
||
|
| |
|
||
|
| |
|
||
|
ted (gip)
|
||
|
| |
|
||
|
+----------------+----------------+
|
||
|
|
|
||
|
|
|
||
|
xdap
|
||
|
|
||
|
|
||
|
Figure 1: Data Flow Through The Staden Suite
|
||
|
|
||
|
|
||
|
The Pharmacia A.L.F. data files in their original format consist of
|
||
|
one file for the (up to 10) samples that were on the gel. The program
|
||
|
alfsplit divides the file up so that each sample is in a file of
|
||
|
its own. From then on each gel reading can be handled individually.
|
||
|
Whether these files can be transferred back to the Compaq for
|
||
|
reprocessing is unknown.
|
||
|
|
||
|
All data from fluorescent based sequencing machines must pass through
|
||
|
the trace editing program ted. Ted allows data vector sequence at the
|
||
|
5' end and unreliable data at the 3' end to be clipped. The sequence
|
||
|
can be edited if desired, though we should stress that this is NOT
|
||
|
RECOMMENDED when used in conjunction with xdap. Ted translates all
|
||
|
Pharmacia A.L.F. uncertainty codes to a hyphen ("-") and outputs the
|
||
|
clipped sequence, along with additional information on the position
|
||
|
and content of cutoffs, to a file.
|
||
|
|
||
|
People wanting to use xdap with ABI and Pharmacia files, but who have
|
||
|
written their own trace clipping software should be aware that xdap
|
||
|
requires information to be passed in the sequence file so that
|
||
|
traces can be displayed. You may want to modify your software to be
|
||
|
compatible with our file format. The file consists of four parts:
|
||
|
|
||
|
1) Cut off information (Optional).
|
||
|
Format is ";%6d%6d%6d%-4s%-16s", where
|
||
|
field 1 = total number of bases called
|
||
|
2 = number of bases in the clipped sequence at the 5' end
|
||
|
3 = number of bases in the sequence in this file
|
||
|
4 = type of trace file.
|
||
|
"ALF " - Pharmacia A.L.F.
|
||
|
"ABI " - ABI 373A
|
||
|
"SCF " - SCF
|
||
|
"PLN " - Text only
|
||
|
5 = name of trace file.
|
||
|
|
||
|
2) Content of the clipped sequence at the 5' end (Optional).
|
||
|
The sequence can extend over several lines. Each line must
|
||
|
begin with ";<" and should be less than 80 characters in
|
||
|
length.
|
||
|
|
||
|
3) Content of the clipped sequence at the 3' end (Optional).
|
||
|
The sequence can extend over several lines. Each line must
|
||
|
begin with ";>" and should be less than 80 characters in
|
||
|
length.
|
||
|
|
||
|
4) Initial tags for the sequence (Optional)
|
||
|
Format is: ";;%4s %6d %6d %s\n", where
|
||
|
field 1 = type of tag to be created (see $STADTABL/TAGDB)
|
||
|
2 = position of tag
|
||
|
3 = length of tag
|
||
|
4 = annotation for tag (optional)
|
||
|
This feature is only available in the program xbap, which
|
||
|
at the time of writing is not yet being distributed with
|
||
|
the package.
|
||
|
|
||
|
5) The sequence, which can extend over several lines. Each
|
||
|
line should be less than 80 characters in length.
|
||
|
|
||
|
Here is a sample file:
|
||
|
|
||
|
; 660 55 450ABI a21d12.s1RES
|
||
|
;<AGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCGGTTCCTTCTGG
|
||
|
;<ATATC
|
||
|
;>-GATAAGCTGATTTG-TTT-CCATTATGGC-GGTTTGAGCCTC-G-GGTC
|
||
|
;>GACCACTCGGTGTGCCAGGAAGGGGTCTGAAATTGAATGGGTTATCACTA
|
||
|
;>GGCGACGTTT--TTTTCAAATTCCGGGCTAAATTTTACGGC-GGA-CGGT
|
||
|
;>TCCG-
|
||
|
;;COMM 1 10 M13mp18 subclone
|
||
|
CAAGACATTTTGAAATACTTGGAATACTGAATCCAAGATGTGGAACATTA
|
||
|
GACATATCCGTGTGCTCAACAATCGACATTTGATCCACTGATGAAAATGT
|
||
|
TCTTCGTTTAGAATTTCTCATAGCATCAGCCACTTTTGCATAATACTCGA
|
||
|
TTGAAGGTTCATGGAAAAAGCTGCGTAGAAGGCATGTCATTGTGCTTACG
|
||
|
AGCCATTTCGGATATCTTGTGAATTTAGCAGGAAGTTCTGTAACTGGTTG
|
||
|
GAATTCAAATATATCAGTTCTTCTTCCTGGATCTCGTCCTTTTTGCACTA
|
||
|
AAACCATTGCGATTGCATCCGGATTCTGAGTAAGAGCCACTACAGCTTTA
|
||
|
TGATACAGGCTCTTGTTATTCCTTTCGTGCTCGAATGGGAACTTTCCAGT
|
||
|
GGCACAAAAATATAGTGTACATCCCAGAGCCCATAGATCACATGTTCCGA
|
||
|
|
||
|
|
||
|
|
||
|
5. Acknowledgements
|
||
|
|
||
|
We would like to thank Applied Biosystems, Inc. and Pharmacia LKB
|
||
|
Biotechnology for their cooperation in agreeing to our routines
|
||
|
accessing the data files of their fluorescent sequencing machines.
|
||
|
|
||
|
373A sequence data file formats are the exclusive property of Applied
|
||
|
Biosystems, Inc.
|
||
|
|
||
|
ALF sequence data file formats are the exclusive property of Pharmacia
|
||
|
LKB Biotechnology, Inc.
|
||
|
|