staden-lg/help/SAP.RNO

2524 lines
92 KiB
Text
Raw Normal View History

2021-12-04 13:07:58 +08:00
.npa
.left margin1
@-1. TX 0 @General
.sp
@-2. T 0 @Screen control
.sp
@-2. X 0 @Screen
.sp
@-3. TX 0 @Modification
.sp
@0. TX -1 @SAP
.left margin2
.PARA
This is an interactive program whose primary use is
for managing shotgun sequencing projects, but it can also be used for
handling alignments of other sequences, including those of proteins.
Currently the maximum 'gel reading' length is set to 4096 characters.
Almost all of the information below describes the use of the program for
shotgun projects, but those using the programs for handling other
sequence
alignments should interpret it accordingly.
The data for such a project is stored in a special type of database. The
program
contains the tools that are required to type in gel readings,
screen them against vector sequences and restriction sites;
enter new gel
readings into the database (automatically comparing and aligning
them). In addition it contains editors and functions to examine the quality
of the aligned sequences.
.para
There are three main menus: "general", "graphics" and "modification",
and some functions have submenus.
.left margin2
.lit
The general menu contains the following options:
0 = List of menus
? = Help
! = Quit
3 = Open a database
4 = Edit contig
5 = Display a contig
6 = List a text file
7 = Direct output to disk
8 = Calculate a consensus
17 = Screen against restriction enzymes
18 = Screen against vector
19 = Check consistency
25 = Show relationships
27 = set parameters
28 = Highlight disagreements
29 = Examine quality
The graphics menu contains:
0 = List of menus
? = Help
! = Quit
10 = Clear graphics
11 = Clear text
12 = Draw ruler
13 = Use cross hair
14 = Change margins
15 = Label diagram
16 = Plot map
33 = Plot single contig
34 = Plot all contigs
The modification menu contains:
0 = List of menus
? = Help
! = Quit
4 = Edit a contig
9 = Screen edit
20 = Auto assemble
21 = Enter new gel reading
22 = Join contigs
23 = Complement a contig
24 = Copy database
26 = Alter relationships
30 = Auto edit a contig
31 = Type in gel readings
32 = Extract gel readings
The enter new gel reading menu contains:
? = Help
! = Quit
3 = Complete entry
4 = Edit contig...
5 = Display overlap
6 = Edit new gel reading...
The join contig menu contains:
? = Help
! = Quit
3 = Complete join
4 = Edit left contig...
5 = Display joint
6 = Edit right contig...
7 = Move join
The alter relationships menu contains:
? = Help
! = Quit
3 = Line change
4 = Edit single gel reading...
5 = Delete contig
6 = Shift
7 = Move gel reading
8 = Rename gel reading
9 = Break contig
The edit menu contains:
? = Help
! = Quit
3 = Insert
4 = Delete
5 = Change
.END LIT
.SK1
.para
Overview of the methodology
.para
The shotgun sequencing strategy
.para
In the shotgun sequencing procedure
the sequence to be determined is randomly broken into fragments of
about
400 nucleotides in length. These fragments are cloned and then
selected randomly and their
sequences determined. The relationship between any pair of
fragments is not known beforehand
but is found by comparing their sequences.
If the sequence of one found to be wholly or partially contained
within that of another for sufficient length to distinguish an
overlap from a repeat then those two fragments can be joined.
The
process of select, sequence and compare is continued until the
whole
of the DNA to be sequenced is in one continuous well
determined
piece.
.para
Definition of a contig
.para
A CONTIG is a set of gel readings that are related to one
another by overlap of their sequences. All gel readings belong to
a contig and each contig contains at least one gel
reading. The gel readings in a contig can be summed to produce
a continuous consensus sequence and the length of this sequence is
the length of the contig. The rules used to perform this summation are
given under "the consensus algorithm".
At any stage
of a sequencing project the data will comprise a number of
contigs;
when a project is
complete there should be only one contig and its consensus will be
the finished sequence. Note that since being introduced and
defined as above the word "contig" has been taken up by those involved in
genomic mapping. In that context the consensus with a precise length is not
defined.
.SK1
.LEFT MARGIN2
Introduction to the computer method
.LEFT margin2
.PARA
It is useful to consider the objectives of a sequencing project before
outlining how we use the computer to help achieve them. The aim of a
shotgun sequencing project is to
produce an accurate consensus sequence from many overlapping gel
readings.
It is necessary to know, particularly at the latter
stages of the project, how accurate the
consensus sequence is. This enables us to know which regions of the
sequence require further work and also to know when the project is
finished.
To show the quality of the consensus, the programs described here
produce displays like that shown below.
.sk1
.lit
10 20 30 40 50
-6 HINW.010 GCGACGGTCTCGGCACAAAGCCGCTGCGGCGCACCTACCCTTCTCTTATA
CONSENSUS GCGACGGTCTCGGCACAAAGCCGCTGCGGCGCACCTACCCTTCTCTTATA
60 70 80 90 100
-6 HINW.010 CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGCCGCGGACACGTC
-3 HINW.007 GGCACA*GTC
CONSENSUS CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGCCG-G-ACA-GTC
110 120 130 140 150
-6 HINW.010 GATTAGGAGACGAACTGGGGCG3CGCC*GCTGCTGTGGCAGCGACCGTCG
-3 HINW.007 GATTAG4AGACGAACTGGGGCGACGCCCG*TGCTGTGGCAGCGACCGTCG
-5 HINW.009 GGCAGCGACCGTCG
17 HINW.999 AGCGACCGTCG
CONSENSUS GATTAGGAGACGAACTGGGGCGACGCC-G-TGCTGTGGCAGCGACCGTCG
160 170 180 190 200
-6 HINW.010 TCT*GAGCAGTGTGGGCGCTG*CCGGGCTCGGAGGGCATGAAGTAGAGC*
-3 HINW.007 TCT*GAGCAGTGTGGGCGCTGC*CGGGCTCGGAGGGCATGAAGTAGAGC*
-5 HINW.009 TCT*GAGCAGTGTGGGCG*T*G*CGGGCTCGGAGGGCATGAAGTAGAGC*
17 HINW.999 TCTCGAGCAGTGTGGGCGCTG**CGGGCTCGGAGGGCATGAAGTAGAGCG
12 HINW.017 GTAGAGC*
CONSENSUS TCT*GAGCAGTGTGGGCGCTG-*CGGGCTCGGAGGGCATGAAGTAGAGC*
.END LIT
.para
This is an example showing the left end of a contig from
position 1 to 200. Overlapping this region are gel readings
numbered 6, 3, 5, 17 and 12;
6, 3 and 5
are in reverse orientation to their original reading (denoted by a minus
sign). Each gel reading also has a name (eg HINW.010). It can be seen that
in a number of places the sequences contain characters other than A,C,G
and
T. Some of these extra characters have been used by the sequencer to
indicate regions of uncertainty in the initial interpretation of the gel
reading, but the asterisks (*) have been inserted by the automatic
assembly function in order to align the sequences. Underneath each 50
character block of gel reading sequences is the consensus derived from
the
sequences aligned above (the line labelled CONSENSUS). For most of its
length the consensus has a definite nucleotide assignment but in a few
positions there is insufficient agreement between the gel readings and
so a dash (-) appears in the sequence. This display contains all the
evidence needed to assess the quality of the consensus: the number of
times
the sequence has been determined on each strand of the DNA, and the
individual nucleotide assignments given for each gel reading.
.para
So the aim is to produce the consensus sequence and, equally important,
a display of the experimental results from which it was derived.
.para
In order to achieve this the following operations need to be performed:
.left margin2
1) Interpret autoradiographs and put individual gel readings into the
computer.
.left margin2
2) Check each gel reading to make sure it is not simply part of one of the
vectors used to clone the sequence.
.left margin2
3) Check each gel reading to make sure that those fragments that span
the
ligation point used prior to sonication are not assembled as single
sequences.
.left margin2
4) Compare all the remaining gel readings with one another to assemble
them
to produce the consensus sequence.
.left margin2
5) Check the quality of the consensus and edit the sequences.
.left margin2
6) When all the consensus is sufficiently well determined, produce a copy
of
it for processing by other analysis programs.
.para
It is very unlikely that this procedure will only be passed through once.
Usually steps 1 to 5 are cycled through repeatedly, with step 4 just
adding
new sequences to those already assembled. Generally step 6 is also used
in
order to analyse imperfect sequence to check if it is the one the project
intended to sequence, or to look for interesting features. Analysis of
the consensus, such as
searches for protein coding regions,
can also help to find errors in the sequence. The display of the
overlapping gel readings shown above can be used to indicate, not only
the
poorly determined regions, but also which clones should be resequenced
to
resolve ambiguities, or those which can usefully be extended or
sequenced
in the reverse direction, to cover
difficult regions.
.PARA
The original
individual gel readings for a sequencing project are each stored in
separate files. As the gel readings are entered into the computer
(usually in batches, say 10
from a film), the file names they are given are stored in
a further file, called a file of file names. Files of file names
enable gel readings to be processed in batches.
.para
For each sequencing project
we start a project database. This database has a structure specifically
designed for
dealing with shotgun sequence data.
In order to arrive at the final consensus sequence many operations will
be
performed on the sequence data. Individual fragments must be
sequenced and
compared in both senses (i.e. both orientations) with all the other
sequences. When an overlap between a new gel reading and a contig are
found
they must be aligned and the new gel reading added to the contig. If a
new
gel reading overlaps two contigs they must be aligned and joined. Before
the two contigs are joined one of them may need to be turned around
(reversed and complemented) so they are both in in the same orientation.
.para
Clearly, keeping track of all these manipulations is quite complicated,
and to be able to perform the operations
quickly requires careful choice of data
structure and algorithms. For these reasons it is not practicable to store
the gel readings aligned as shown in the display above. Rather, it is more
convenient to store the sequences unassembled, and to record sufficient
information for programs to assemble them during processing. The
data used to assemble the sequences is called relational information.
.left margin2
.PARA
The database comprises three files and they are described under the
section entitled "open database".
.PARA
Before entry into the project database
each new gel reading must be compared to look for overlaps
with all the data already contained
within the database. This last point is
important: all searching for overlaps is between individual new gel
readings and the data already in the database. There is no searching for
overlaps between sequences within the database; overlaps must be found
before new gel readings are entered into the database.
.para
Below I give an introduction to how the sequencess are processed by
being
passed from one function to the next.
.para
This program is used to start a
database for the project and
then the following procedure is used.
.para
Data in the form of individual gel readings are entered into the computer
and stored in separate files using either program this program or the digitizer
program. Batches
of these gel readings
are passed to the screening functions in this program to search for overlaps
with vector sequences ("screen against vector") or for matches to
restriction enzyme sites that should not be
present ("screen against enzymes").
Each run of these screening functions passes on only those gel
readings that do not contain unwanted sequences. Sequences are passed
via
files of file names and eventually are processed by the automatic
assembly function ("auto assemble"). This function compares each gel
reading with a consensus of all the previous gel readings
stored in the database.
If it finds any
overlaps
it aligns the overlapping sequences by inserting padding characters,
and then adds the new gel reading to the database.
Gels that overlap are added to existing contigs and gels that do not
overlap any data in the database start
new contigs. If a new gel overlaps two contigs they are joined.
Any gel readings that appear to overlap but which
cannot be aligned sufficiently well are not entered and have
their names written to a file of failed gel reading names.
.PARA
Generally data is entered
into the database in batches as just described. The program
is also used to examine
the data in the database, to enter gel readings that the automatic
assembly function cannot align ("enter new gel reading"),
and to make final edits. Edits to whole contigs
can be made in several ways. An automatic editor ("auto edit") will
perform almost all edits without any user intervention, but the program
also gives access to the system editor (EDT on the VAX), through the
function "screen edit", and to simple command driven editors ("edit
contig" and "edit new gel reading"). Disagreements between gel readings
in contigs and their consensus
sequences can be highlighted by use of the function "highlight
disagreements".
.PARA
Editing the sequences is obviously an essential part of managing a
sequencing project.
Editing is required when new
sequences are added, when contigs are joined, and when sequences are
corrected.
A basic part of the strategy
used here is that new
gel readings should be correctly aligned throughout their whole length
when
they are entered into the database, and that when contigs are joined they
are edited so that they are well aligned in the region of overlap.
Alignment can be achieved by
adding padding characters to the sequences, and this is the way "auto
assemble"
operates when adding new sequences to the database.
.para
In order to search
for overlaps that may have been missed due to errors in
the gel readings, the function "extract gel readings" can be used to take
copies of the gel
readings at the ends of contigs, and write them out as separate files.
These can then be compared with the database consensus using the "auto
assemble" function in a mode that forbids entry of data into the
database,
and any gel reading matching two contigs will indicate a join that has
been
missed. The joins can then be made interactively using "join contigs".
Missed matches can be
found at this stage because the errors in the sequences may have been
corrected by new data.
.para
Generally the users need not concern themselves with how the relational
information is used by the program, but it is necessary to know
how contigs are identified. Because contigs are constantly being changed and
reordered the program identifies them by the numbers of the gel readings
they contain. Whenever users need to identify a contig they need only
know
the number or name of one of the gel readings it contains. Whenever the
program asks users to identify a contig or gel reading they can type its
number or its archive name. If they type its archive name they must precede
the name by a slash "/" symbol to denote that it is a name rather than a
number. E.g if the archive
name is fred.gel with number 99, users should
type /fred.gel or 99 when asked to identify the contig. Generally,
when it asks for the gel reading to be identified,
the program will offer the user a default name,
and if the user types only return, that
contig will be accessed. When a database is opened the default contig will
be the longest one, but if another is accessed, it will subsequently become
the current default.
.para
Further information is located in the following places.
The database files are described under "open database". The format
for
vector and consensus sequences is given under "calculate a consensus", as are
the
uncertainty codes used in gel readings.
.left margin2
.para
The only program, other than this, relevant to sequencing is the digitizer
program and it is outlined briefly below.
.para
The digitiser program
is used for the initial input of gel readings
and for writing a file of file names. The program
uses a digitizer for data entry.
A digitizer is
a two dimensional surface such as a light box
which is such that if a special pen is pressed onto it, the pens
coordinates are recorded by a computer.
These coordinates
can be interpreted by a program.
.para
In order to read an autoradiograph placed on the light box
the user need only define the bottom of
the four sequencing lanes and the bases
to which they correspond and then use the pen to point to each
successive band progressing up the gel. The program examines
the
coordinates of each pen position to see in which of the four
lanes
it lies and assigns the corresponding base to be stored in the
computer. Each time the pen tip is depressed to point to a position
on the surface of the digitizer the program sounds the bell on the
terminal to indicate to the user that a point has been recorded. As
the sequence is read the program displays it on the screen.
.left margin1
@17. TX 1 @Screen against restriction enzymes
.left margin2
.PARA
Used to compare gel readings against any restriction enzyme recognition
sequences that may have been used during cloning and which should not
be present in the data. Works on single gel readings or processes batches
accessed through files of file names. The algorithm looks for exact
matches to recognition sequences stored in a file.
.para
The file containing the recognition sequences must be identified. The
user
must choose between employing a file of file names, or typing in the
names of individual gel reading files. If a file of file names is used the
program will also create a new file of file names. When the option has
finished operating this new file will contain the names of all those gel
readings that did not match any of the recognition sequences. Hence it
can
be used for further processing of the batch. The recognition sequences
should be stored in a simple text file with one recognition sequence per
line.
.left margin1
@18. TX 1 @Screen against vector
.left margin2
.PARA
Used to compare gel readings against any vector sequences that may have
been picked up during cloning. Works on single gel readings or processes
batches accessed through files of file names. The algorithm looks for
exact
matches of length "minimum match length" and displays the overlapping
sequences.
.para
The file containing the vector sequence must be identified. The user must
choose between employing a file of file names, or typing in the names of
individual gel reading files. If a file of file names is used the program
will
also create a new file of file names. When the option has finished
operating this new file will contain the names of all those gel readings
that did not match the vector sequence. Hence it can be used for further
processing of the batch.The vector sequence should be stored in a simple
text file with up to 80 characters of data per line. More than one vector
can be stored in a single file. If so each should be preceded by a 20
character title of the form <---m13mp8.001-----> where the < and >
signs
and the number like .001 are obligatory. The number must be preceded
by a dot (.) and be 3 digits long. The total sequence in the file must be <
50,001 characters in length.
.left margin1
@20. TX 2 @Auto assemble
.left margin2
.PARA
Compares gel readings against the current contents of the database and
produces alignments. In its normal mode of operation
("entry permitted"), the function
will automatically enter the gel readings into the database, but if entry
is not permitted it will only produce alignments. It works on
single gel readings or processes batches of gel readings accessed through
files of file names. It is the usual way to enter data into the database.
.para
The function will check the database for logical consistency and will
only
procede if it is OK. Choose if gel readings should be entered into the
database, or if they should only be compared. Choose between using a file
of file names or typing file names on the keyboard. If so selected, supply
the file of file names. Also supply a file of file names to contain the names of
all the gel readings that fail to get entered.
Select the entry mode. Normal assembly is appropriate for all but special
cases, as is "permit joins". Uses for the other modes are not documented
here.
Define a minimum initial
match length. Define a minimum alignment block (the default value is
taken in all but exceptional circumstances). Define the maximum number
of paddding characters allowed to be used in each gel reading to help
achieve alignment, and the same for the number allowed in the contig for
each gel reading. Finally define the maximum percentage mismatch to
be allowed for any gel reading to be entered into the database. If
for any gel reading, either of these last three values is exceeded the gel
reading will not be entered into the database.
.para
In operation the function takes a batch of gel readings (probably passed
on as a file of file names from one of the screening routines) and
enters them into a
database for a sequencing project. It takes each gel reading
in turn,
compares it with the current consensus for the database, it then
produces an alignment for any regions of the consensus it
overlaps; if this alignment is sufficiently good it then edits
both the new gel reading and the sequences it overlaps and adds
the
new gel reading to the database. The program then updates the
consensus
accordingly and carries on to the next gel reading.
.para
All alignments are displayed and any gel readings
that do match but that
cannot be aligned sufficiently well have their names written to a
file of failed gel reading names. The function works without any
user intervention and can process any number of gel readings in a
single run. Those gel readings that fail can be recompared using
the same function (to find the current overlap position) and the
user can enter them into the database
manually using the "enter new gel reading" option.
.para
Typical dialogue and output from the function is shown below. (Note that
output for gel readings 2 - 9 has been deleted to save space).
.lit
Automatic sequence assembler
Database is logically consistent
? (y/n) (y) Permit entry
? (y/n) (y) Use file of file names
? File of gel reading names=demo.nam
? File for names of failures=demo.fail
Select entry mode
X 1 Perform normal shotgun assembly
2 Put all sequences in one contig
3 Put all sequences in new contigs
? Selection (1-3) (1) =
? (y/n) (y) Permit joins
? Minimum initial match (12-4097) (15) =
? Minimum alignment block (2-5) (3) =
? Maximum pads per gel (0-25) (8) =
? Maximum pads per gel in contig (0-25) (8) =
? Maximum percent mismatch after alignment (0.00-15.00) (8.00) =
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing 1 in batch
Gel reading name=HINW.004
Gel reading length= 283
Searching for overlaps
Strand 1
Strand 2
No matches found
Total matches found 1
Padding in contig= 0 and in gel= 1
Percentage mismatch after alignment = 1.8
Best alignment found
1 11 21 31 41 51
TTTTCCAGCG TGCGTCTGAC GCTGTCTTGC TTAATGATCT CCATCGTGTG CCTAGGTCTG
********** ********** ********** ********** ********** **********
TTTTCCAGCG TGCGTCTGAC GCTGTCTTGC TTAATGATCT CCATCGTGTG CCTAGGTCTG
1 11 21 31 41 51
61 71 81 91 101 111
TTGCGTTGGG CCGAGCCCAA CTTTCCCAAA AACGTATGGA TCTTACTGAC GTACA-GTTG
********** ********** ********** ********** ********** ***** ****
TTGCGTTGGG CCGAGCCCAA CTTTCCCAAA AACGTATGGA TCTTACTGAC GTACACGTTG
61 71 81 91 101 111
121 131 141 151 161 171
CTTACCAGCG TGGCTGTCAC GGCGTCAGGC TTCCACTTTA GTCATCGTTC AGTCATTTAT
********** ********** ********** ********** ********** **********
CTTACCAGCG TGGCTGTCAC GGCGTCAGGC TTCCACTTTA GTCATCGTTC AGTCATTTAT
121 131 141 151 161 171
181 191 201 211 221 231
GCCATGGTGG CCACAGTGAC G-TATTTTGT TTCCTCACGC TCGCTACGTA TCTGTTTGCC
********** ********** * ******** ********** ********** **********
GCCATGGTGG CCACAGTGAC GCTATTTTGT TTCCTCACGC TCGCTACGTA TCTGTTTGCC
181 191 201 211 221 231
241 251 261 271 281
CGCG--GTGG AATTACAGCG TTCCCTATTG ACGGGCGCAT CCAC
**** **** ********** ** * ***** ********** ****
CGCGACGTGG AATTACAGCG TT,CDTATTG ACGGGCGCAT CCAC
241 251 261 271 281
Batch finished
9 sequences processed
0 sequences entered into database
0 joins made
.end lit
.para
Note that "auto assemble" cannot align protein sequences.
.left margin1
@28. TX 1 @Highlight disagreements
.left margin2
.para
Used in the latter stages of a project
to highlight disagreements between individual gel readings
and their consensus sequences. Characters that agree with the
consensus are shown as : symbols for the plus strand and . for the minus
strand. Characters that disagree with the consensus are left unchanged
and so stand out clearly. The results of this analysis are written to a
file.
.para
Before selecting this option create a file of the display of the contig to
be
"highlighted". The option will ask for the name of this file. Select
symbols
to denote "agreeing" characters on each strand, the defaults are : and .,
but any others can be used. Supply the name of a file in which to put
the output.
.para
The display file needed as input for this option is created by selecting
"Redirect output", followed immediately by "display contig", and then
"Redirect output" again. The
cutoff score used in the consensus calculation can be set by option "set
display parameters". Note that for the highlight function
there is a limit of 50 for the number of gel
readings that are aligned at any position - ie the contig must be less
than 51 gel readings deep at its thickest point. I hope that those performing
shotgun sequencing never reach this limit, but those using the program for
comparing sequence families might.
.para
Typical output from this function is shown below.
.lit
210 220 230 240 250
1 HINW.004 :C::::::::::::::::::::::::::::::::::::::::::AC::::
7 HINW.018 :*::::::::::::::::::::::::::::::::::::::::::CA::::
-4 HINW.017 ...............AC....
G-TATTTTGTTTCCTCACGCTCGCTACGTATCTGTTTGCCCGCG--GTGG
260 270 280 290 300
1 HINW.004 ::::::::::::*:D:::::::::::::::::::
7 HINW.018 ::::::::::::::::::::CA:::::T:*:::*::::::::::::CA:
-4 HINW.017 ..............................................A...
3 HINW.009 :::::::::::::::V::::::::::::::::::::::::::::*AV:::
-6 HINW.028 ......................A...
AATTACAGCGTTCCCTATTGACGGGCGCATCCACGCTGATTCTCTT-CTG
.end lit
.left margin1
@32. TX 3 @Extract gel readings
.left margin2
.para
Used to make copies of the aligned gel readings in a database,
to write them into separate files, and to write a
corresponding file of file names. It operates in two modes: either all gel
readings are extracted, or only those at the ends of contigs.
.para
Choose which mode of operation is required and supply a file of file
names.
.para
The gel readings are given their original
names.
If used to extract the gel readings from the ends of contigs the function
is
useful for checking for missed contig joins: the file of file names can be
used with the auto assemble function to recompare these gel readings,
and each should only overlap one contig. Any that overlap two contigs
will identify possible joins.
.para
If the option is used to extract all the gel readings from a database, a
subsequent run of "auto assemble" can reconstitute a database which has
been corrupted. This rarely occurs and is usually necessesitated by a
user employing "alter relationships" incorrectly without first having
made a copy.
.left margin1
@1. TX 0 @Help
.left margin2
.PARA
Help is available on the following topics :
.LEFT MARGIN1
@2. TX 0 Quit
.LEFT MARGIN2
.PARA
This command stops the program and is the only safe way to terminate a
run
of the program that has altered the contents of the database in any way.
.left margin1
@3. TX 1 @Open a database
.LEFT MARGIN2
.PARA
Opens existing databases or allows new ones to be started. The function
is
automatically called into operation
when the program is started but can also be selected
from the general menu.
.para
Choose to open an existing database or start a new one, or if ! is typed
when the program is first started, enter the program without opening a
database. Supply a project
database name, and if it already exists, the "version". If starting a new
database define the database size and if it is for DNA or protein sequences.
The database size is an initial size for the database. It can be increased
later during the project. It is the sum of the number of gel
readings plus the number of contigs.
.para
Database names can have from one to 12 letters and must not include full
stop (.). The database is made from three separate files. If the database
is
called FRED then version 0 of database FRED comprises files FRED.AR0,
FRED.RL0 and FRED.SQ0. The version is the last symbol in the file names.
Only this program
can read these files. If the "copy database" option is used it
will ask the user to define a new "version".
.para
For normal use the maximum gel reading length is set to 512 characters,
but when a database is started the user may choose lengths of either
512,
1024, 1536..., 4096. Normally the program is used to handle DNA
sequences but many of the functions also work on protein sequences. The
choice of sequence type is made when the database is started.
.para
The contigs are not stored on the disk as the user sees them displayed on
the screen. Each gel reading is stored with sufficient information about
how it overlaps other gel readings so that the program can work out how
to
present them aligned on the screen. We refer to this extra data as "the
relationships" and it is explained below.
The database comprises 3 separate files.
.left margin2
1. a working version of each gel reading. This is the version of
the gel reading
that is in the database and initially it is an exact copy of
the original sequence (known as the archive)
but it is edited and manipulated to align it
with other gel readings.
.left margin2
2. the file of relationships. This file contains all of the
information that is required to assemble the working versions
into
contigs during processing; any manipulations on the data use this
file and it is automatically updated at any time that the
relationships are changed. The information in this file is as
follows:
.left margin2
(A) Facts about each gel reading and its relationship to
others
("gel
descriptor lines"):
.left margin2
(a) the number of the gel
reading (each gel reading is given a number as it is
entered into the database)
.left margin2
(b) the length of the sequence from this gel reading
.left margin2
(c) the position of the left end of this gel
reading relative to the left
end of the contig of which it is a member
.left margin2
(d) the number of the next gel
reading to the left of this gel reading
.left margin2
(e) the number of the next gel reading to the right
.left margin2
(f) the relative strandedness of this gel
reading , ie whether it is in
the same sense or the complementary sense as its archive.
.left margin2
(B) Facts about each contig ("contig descriptor lines"):
.left margin2
(a) the length of this contig
.left margin2
(b) the number of the leftmost gel
reading of this contig
.left margin2
(c) the number of the rightmost gel reading of this contig.
.left margin2
(C) General facts:
.left margin2
(a) the number of gel readings in the database
.left margin2
(b) the number of contigs in the database.
.left margin2
3. the file of archive names. This is simply a list of the names
of each of the archive files in the database but on line number
1000 we also store the size of the database. ie the number of lines
of information allowed in the database files. This file always has
1000 lines but the length of the file of relationships and the file
of working versions can be set by the user when creating a
database
or when copying from one to another.
.para
Structure of the database files
.para
1. The file of relationships
.para
The file contains IDBSIZ lines of data:
the general data are stored on line IDBSIZ; data about gel
readings are
stored from line 1 downwards; data about contigs are stored from
line IDBSIZ-1 upwards. A database of 500 lines containing 25 gel
readings and 4 contigs would have a file
of relationships as is shown below.
.lit
---------------------------------------------
1 Gel descriptor record
2 " " "
3 " " "
4 " " "
5 " " "
' ' ' '
' ' ' '
25 " " "
26 Empty record
' ' '
' ' '
495 ' '
496 Contig descriptor record
497 " " "
498 " " "
499 " " "
500 Number of gel readings=25, Number of contigs=4
---------------------------------------------
The arrangement of the data in the file of relationships
.end lit
As each new gel reading is added into the database a new line is added
to the end of the list of gel descriptor
lines. If this new gel reading does not
overlap with any gel readings
already in the database a new contig line is
added to the top of the list of contig lines. If it overlaps with
one contig then no new contig line need be added but if it overlaps
with two contigs then these two contigs must be joined and the
number of contig lines will be reduced by one. Then the list of
contig
lines is compressed to leave the empty line at the top of the list.
Initially the two types of line will move towards one another but
eventually, as contigs are joined, the contig descriptor lines will
move in the same direction as the gel descriptor
lines. At the end of a
project there should be only one contig line. The database is thus
capable of handling a project of 998 gels.
.para
Structure of the working versions file
.para
The working versions of gel readings are stored in a file of
IDBSIZ lines each containing 512 characters. Gel reading
number 1 is stored on line
1, gel reading number 2 on line 2 and so on.
.para
Structure of the archive names file
.para
This file, unlike the others, always has 1000 lines each 10
characters in length. Its length is fixed because line 1000 is used
to store IDBSIZ the database size and the programs need a definite
location from which to read this number.
.para
Safeguarding the database
.para
It is advisable to copy regularly (using the copy function of
DS) from say copy 0 to copy 1 in case of errors.
.para
I also recommend setting the protection codes on copy 0 of each database
so
that users cannot delete the files without first resetting the protection
codes. This will protect you from accidently deleting the files. Users at
LMB can use the PROTECT command for this purpose.
.para
The give-up options allow users to change their minds
about entering a new gel reading or joining two contigs without
affecting the file of relationships. BUT if the edit
contig option from either of these two functions has been
used
the edits will
remain even though the user has "given up". To leave the files
completely
unaffected the user could, if required, undo any edits before
"giving up".
.para
There are various checks within the programs to
protect users from themselves:-
.left margin2
1. All user input is checked for errors - e.g. reference to
non-existent gel
readings or contigs, incorrect positions in the
contig or gel readings.
.left margin2
2. Before entering a gel reading the system checks to see if a
file of the same name has already been entered.
.left margin2
3. Join will not allow the circularising of a contig.
.left margin2
4. Both enter and join functions restrict the region
that the user is allowed to edit (using edit contig) to the
region of overlap.
.left margin2
5. Users may escape from any point in the program.
.left margin2
6. Help is available from all points in the program.
.SK2
.LEFT MARGIN2
IT IS ESSENTIAL THAT USERS DO NOT KILL THE PROGRAM WHILE IT IS
DOING
ANYTHING THAT INVOLVES CHANGING THE CONTENTS OF THE
DATABASE. I.E DURING AUTO ASSEMBLE,
COMPLETE ENTRY, COMPLETE JOIN, COMPLEMENT CONTIG, EDIT CONTIG, AND SCREEN
EDIT.
This could
corrupt the database so badly that it is impossible to fix. The program
should always be left using the QUIT option.
.left margin1
@4. TX 3 @Edit
.LEFT MARGIN2
.PARA
A simple commnd driven editor that can insert, delete and change gel
reading sequences.
Insert, delete and change commands will request the position at which
the edit is required and the number of characters to insert, delete or
change. The default character for insertions is *.
.para
There are three modes of editing offered by this editor depending
where it is selected from. New gel readings
can be edited as they are
being entered into the database, contigs can be edited with alignments
being automatically maintained, or gel readings in contigs can be edited
without the maintenance of alignments.
.LEFT MARGIN2
The following commands can be used.
.lit
? = Help
! = Quit
3 = Insert
4 = Delete
5 = Change
.end lit
.para
All commands request the position at which the edit should be made.
(Note that the position refers to the position in the contig for
gel readings in the database, but to the position in the gel
reading if you are editing a new gel reading while entering it into the
database.)
.para
All commands request the number of characters to operate on.
(Note that
if you are editing a contig the program will ask for the
characters to insert into each separate gel reading, hence allowing
different changes to be made to each. Also the default character is
asterisk (*) - i.e if you include a space in the string it will be replaced
by an asterisk, or if you simply type return the whole string inserted will
be asterisks.)
.LEFT MARGIN2
"Change" allows characters in individual gel readings to be
replaced.
If the user is not editing a new gel reading during "enter new gel reading"
the program will request the numer of the gel reading to edit.
(When editing gel readings in contigs
the program responds with the relative position and length of
the selected gel reading
in case the the user only knows the edit
position relative to the gel reading.
(The edit position must be
relative to the contig.))
.left margin2
Further notes on editing
.PARA
When you are editing a contig
the program maintains the alignments of the gel readings
by always making the same number of insertions or deletions in
all
the gels. Note that these edits are immediately carried out and the
"Quit" options of "enter new gel reading" and "join contigs"
do not undo them. Users must
undo them themselves. Note that if this option has been entered
from
either "enter new gel reading" or "join contigs"
the program will restrict edits to
the region of overlap.
DO NOT KILL THE PROGRAM DURING EDIT CONTIG!
.para
When editing a single gel reading in a contig from "alter relationships"
(which you should not normally
need to do) the program will
correct the length of the individual gel reading, but it will not update
the length of the contig if it has changed.
.para
The program contains better methods than this simple command driven editor,
for making
multiple edits to contigs. "Screen edit",
gives access to the system editor on your machine, and "auto edit" will
edit a whole contig automatically.
.left margin1
@9. TX 3 @Screen edit
.LEFT MARGIN2
.para
Gives access to the system editor on the machine (for example EDT on a VAX)
and allows users to edit contigs. The contigs are presented as for
"display contig" and the program will
reconstitute the contig's sequences and relationships when the editor is
exited.
.para
To screen edit a contig set the line length to 50 characters,
select the contig to edit, and supply the name of a temporary file in which
the editing will be performed.
After a short pause the system
editor will present the first page of the file. Edit the file obeying the
rules given below. Exit from the editor and affirm the intention of
returning the contig to the database. The program will put the contig
back into the database.
.para
Rules for screen editing
.para
There are some limitations on the changes that can be made to the contigs
when using the screen editor. Users are unlikely to want to break the
rules
in order to achieve changes to contigs, but nevertheless the
constraints need to be defined and they are given below.
.para
Alignments must be maintained during editing.
Whole lines of sequence should not be deleted or added unless the
order
of the gel readings in the contig is preserved.
Each line in the
contig display consists of gel reading numbers, their names and 50
character sections of sequence. Insertions are limited in the following
way.
No line of sequence can be extended rightwards more than 10 characters
beyond the end of a full length line (a full length line is 50 characters
long). Only one character can be added to the left end of full length
lines, but sections of sequence beginning further into a line
can be extended leftwards up to an equivalent position. Do not delete any
non-sequence lines in the file.
.para
Before returning the contig to the database the program checks that the
rules have been obeyed. If an error is found the number of the erroneous
line in the
file is displayed and the contig will not be changed.
.left margin1
@5. TX 1 @Display a contig
.LEFT MARGIN2
.para
Used to show the aligned gel readings for any part of a contig. The
number, name and strandedness of each gel reading is shown and the
consensus is written below.
.para
If required identify the contig, and then the start and end points of the
region to display.
.para
The display can be directed to a disk file using "direct output to disk".
These files are required by options: "screen edit" and "highlight
disagreements", and printed copies of them
are very useful for marking corrections prior to
using the editors.
.para
Below is an example showing the left end of a contig from
position 1 to 200. Overlapping this region are gels 6,3,5,17and 12;
6, 3 and 5
are in reverse orientation to their archives (denoted by a minus sign)
There are a few uncertainty codes and a few padding
characters in the working versions, but the consensus (shown
below
each page width) has a definite assignment for almost every
position.
.lit
10 20 30 40 50
-6 HINW.010 GCGACGGTCTCGGCACAAAGCCGCTGCGGCGCACCTACCCTTCTCTTATA
CONSENSUS GCGACGGTCTCGGCACAAAGCCGCTGCGGCGCACCTACCCTTCTCTTATA
60 70 80 90 100
-6 HINW.010 CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGCCGCGGACACGTC
-3 HINW.007 GGCACA*GTC
CONSENSUS CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGCCG-G-ACA-GTC
110 120 130 140 150
-6 HINW.010 GATTAGGAGACGAACTGGGGCG3CGCC*GCTGCTGTGGCAGCGACCGTCG
-3 HINW.007 GATTAG4AGACGAACTGGGGCGACGCCCG*TGCTGTGGCAGCGACCGTCG
-5 HINW.009 GGCAGCGACCGTCG
17 HINW.999 AGCGACCGTCG
CONSENSUS GATTAGGAGACGAACTGGGGCGACGCC-G-TGCTGTGGCAGCGACCGTCG
160 170 180 190 200
-6 HINW.010 TCT*GAGCAGTGTGGGCGCTG*CCGGGCTCGGAGGGCATGAAGTAGAGC*
-3 HINW.007 TCT*GAGCAGTGTGGGCGCTGC*CGGGCTCGGAGGGCATGAAGTAGAGC*
-5 HINW.009 TCT*GAGCAGTGTGGGCG*T*G*CGGGCTCGGAGGGCATGAAGTAGAGC*
17 HINW.999 TCTCGAGCAGTGTGGGCGCTG**CGGGCTCGGAGGGCATGAAGTAGAGCG
12 HINW.017 GTAGAGC*
CONSENSUS TCT*GAGCAGTGTGGGCGCTG-*CGGGCTCGGAGGGCATGAAGTAGAGC*
.END LIT
.left margin1
@6. TX 1 @List a text file
.LEFT MARGIN2
.PARA
This option allows users to list text files on the screen. It can be used
to read a file containing notes, for checking files written to disk etc. The
user is asked to type the name of the file to list.
.left margin1
@8. TX 1 @Calculate a consensus
.LEFT MARGIN2
.para
Calculates a consensus sequence either for the whole database or
for selected contigs. The consensus is written to a file named by the
user.
.left margin2
Supply a file name, choose between whole database or selected contigs.
.para
Symbols for uncertainty in gel readings
.para
In order to record uncertainties when reading gels the codes shown
below can be used. Use of these codes permits us to extract the
maximum amount of data from each gel and yet record any doubts by
choice of code. The program can deal with all of these codes and any
other characters in a sequence are treated as dash (-) characters.
.lit
SYMBOL MEANING
1 PROBABLY C
2 " T
3 " A
4 " G
D " C POSSIBLY CC
V " T " TT
B " A " AA
H " G " GG
K " C " C-
L " T " T-
M " A " A-
N " G " G-
R A OR G
Y C OR T
5 A OR C
6 G OR T
7 A OR T
8 G OR C
- A OR G OR C OR T
a A set by auto edit
c C set by auto edit
g G set by auto edit
t T set by auto edit
* padding character placed by auto assembler
else = -
.end lit
.LEFT MARGIN2
The DNA consensus algorithm
.para
The "calculate consensus" function, the "display contig" routine and the
"show quality" option use the rules outlined here to calculate a
consensus from aligned gel readings. Note that "display contig"
calculates
a consensus for each page width it displays (it does not use the
consensus sequence file calculated by the consensus function).
.LEFT MARGIN2
.para
We have 6 possble symbols in the consensus sequence: A,C,G,T,* and -. The
last symbols is assigned if none of the others makes up a sufficient
proportion of the aligned characters at any position in the contig. The
following calculation is used to decide which symbol to place in the
consensus at each position.
.para
Each uncertainty code contributes a score
to one of A,C,G,T,* and also to the total at each point. Symbols like R
and Y which don't correspond to a single base type contribute only to the
total at each point. The scores are shown below.
.lit
definite assignments ie A,C,G,T,B,D,H,V,K,L,M,N,a,c,g,t,* =1
probable assignments ie 1,2,3,4 = 0.75
other uncertainty codes including R,Y,5,6,7,8,- = 0.1
.end lit
.para
A cutoff score of 51% to 100% is supplied by the user. (When the program
starts this is set to 75%. See "set display parameters").
At each position in the contig we calculate the total score for each of
the 5 symbols
A,C,G,T and * (denote these by Xi, where i=A,C,G,T or *),
and also the sum of these totals
(denote this by S). Then if 100 Xi / S > the cutoff for any i, symbol i is
placed in the consensus; otherwise - is assigned.
.para
Notice that S does not equal the number of times the sequence has been
determined, but is the score total, and hence we are less likely to put a -
in the consensus. For the "examine quality" algorithm each strand is
treated separately but the calculation is the same. (It was originally
different).
.para
Format of the consensus sequence ( and vector sequences).
.para
A consensus sequence file may contain the consensus for several contigs
and so we identify each of them by preceding them by a 20 character
title. The title is of the form <---LAMBDA.076-----> ( where LAMBDA is
the project name and gel reading number
76 is the leftmost gel
reading to contribute to this consensus sequence).
The angle brackets <> and the three digit number precede by a .
are important to some processing programs.
.left margin1
@25. TX 1 @Show relationships
.LEFT MARGIN2
.para
Used to show the relationships of the gel readings in the database in
three ways -
.LEFT MARGIN2
(a) All contig descriptor lines followed by all gel descriptor
lines.
.LEFT MARGIN2
(b) All contigs one after the other sorted, i.e. for each
contig show its contig descriptor line followed by all its
gel descriptor lines sorted on position from left to right
.LEFT MARGIN2
(c) Selected contigs: show the contig line and, in order,
those gel readings that cover a user-defined region.
Note that this output can be directed to a disk file by
prior selection of "disk output".
.LEFT MARGIN2
.para
Below is an example showing a contig from position
1 to 689. The left gel reading is number 6 and has archive
name HINW.010, the
rightmost gel reading is number 2 and is has archive name HINW.004.
On each gel descriptor line is shown:
the name of the archive version, the gel number, the position of the
left end of the gel reading relative to the left end of the contig, the
length of the gel
reading (if this is negative it means that the gel reading is in
the opposite orientation to its archive), the number of the gel
reading to
the left and the number of the gel reading to the right.
.lit
CONTIG LINES
CONTIG LINE LENGTH ENDS
LEFT RIGHT
48 689 6 2
GEL LINES
NAME NUMBER POSITION LENGTH NEIGHBOURS
LEFT RIGHT
HINW.010 6 1 -279 0 3
HINW.007 3 91 -265 6 5
HINW.009 5 137 -299 3 17
HINW.999 17 140 273 5 12
HINW.017 12 193 265 17 18
HINW.031 18 385 -245 12 2
HINW.004 2 401 -289 18 0
.end lit
.left margin1
@21. TX 3 @Enter new gel reading
.LEFT MARGIN2
.para
Used to enter new gel readings into the
database. The new gel reading must have previously been compared with
the
contents of the database by use of " auto assemble" in order to ascertain
if it overlaps any previously entered data.
.para
The user is expected to know: if
the gel reading overlaps; if so which contig it overlaps; if so where it
overlaps. The program takes the user through a series of question to
establish the nature of the overlap and then displays the overlap. The
user
is then offered a number of options, including editors for the new gel
reading and the contig, to enable the correct alignment of the gel reading
throughout its whole length.
.left margin2
Supply the name of the gel reading file.
If the gel
reading has been entered before the program will not permit
entry.
The program gives the gel reading a unique number and asks if the
sequence overlaps any data already in the database (reported by "auto
assemble").
If it does not, entry is complete.
If it does overlap the
dialogue
continues with the program asking if the gel readings overlaps "in the
normal sense", if not it will automatically complement the sequence.
Then supply the number of the contig the gel reading overlaps (as
reported by "auto assemble").
.para
Overlaps are divided into two types: those for which the new gel reading
protrudes from the left end of the contig it overlaps, and those for which
it does not. The program asks about this with the question "Left end of
gel
reading is inside contig". If this is true the program will go on to ask for
the position in the contig of the left end of the new gel reading. If it is
not
true the program will ask for the position in the new gel reading of the
left end of the contig.
.para
Once this is completed the program will display the first 50 bases of
the overlap.
The gel readings in the contig and their consensus are displayed with the
new gel reading underneath. The mismatches are shown by *'s on the
next
line down.
For example:
.lit
60 70 80 90 100
-6 HINW.010 CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGCCGCGGACACGTC
-3 HINW.007 GGCACA*GTC
CONSENSUS CACAAGCGAGCGAGTGGGGCACGGTGACGTGGTCACGCCG-G-ACACGTC
NEWGEL CACAAGCGAGCGAGAGGGGCACCGTGACGTGGTCACGCCGGGGACACGTC
MISMATCH * * *
10 20 30 40 50
.end lit
.para
The program then needs to know if the position of the left end of the
overlap is correct.
If it is the user should type return, if not, 1 and the program will ask for
the
new position and display it.
.LEFT MARGIN2
The program now offers a number of options to allow the
user to align the new gel reading
correctly over its whole length with
the data already in the contig. It is important that
sufficient edits are made to the new gel reading
or the sequences in the
contig at this stage to get the alignment correct, because once
entry is completed, the alignment is fixed and cannot easily be
changed (see "alter relationships").
Alignment can be achieved
by making
insertions or deletions but deletion of data requires the
original gels to be checked. For this reason at entry we
usually make only insertions to achieve alignment. We use X or
asterisks (*) as padding characters to achieve alignment and
so can, if required,
distinguish padding characters from characters assigned from
reading gels.
.LEFT MARGIN2
.para
The options available are:
.lit
? = HELP
! = Give up
3 = Complete entry
4 = Edit contig
5 = Display overlap
6 = Edit new gel reading
.end lit
.sk1
.para
1. HELP gives this information.
.para
2. Give up allows users to change their minds about entering the new gel
reading. The program will ask the user to
confirm this choice.
.para
3. Complete entry is the command to add the new gel reading to the
contig. The
program updates the relationships accordingly. The user is asked to
confirm
this command.
.para
4. Edit contig gives the user access to a simple editor that allows
insertions, deletions and changes to be made to the contig. The editor
maintains alignments by making the same number of insertions or
deletions
in all sequences covering the edit position.
The program
protects the user by allowing edits only within
the region of overlap.
.para
5. Display allows display of the region of overlap only. This
is defined by the relative positions in the contig. The
default is the whole of the region of overlap.
.para
6. Edit new gel reading allows the new gel reading to be edited using a
simple editor.
.left margin1
@23. TX 3 @Complement a contig
.LEFT MARGIN2
.PARA
This function will complement and reverse all of the gel
readings in a
contig. It automatically reverses and complements each gel
reading sequence, reorders left and right neighbours, recalculates
relative
positions and changes each strandedness.
.PARA
The only user input required is to identify the contig to
complement by the number or name of a gel reading it contains.
DO NOT KILL THE
PROGRAM DURING THIS STEP!
.left margin1
@22. TX 3 @Join contigs
.LEFT MARGIN2
.PARA
This function joins contigs interactively. It allows the
user to align the ends of the two contigs by editing each
contig separately. It is important that the alignment achieved is
correct because once the join is completed the alignment is fixed.
The program needs to know which two contigs to join and where they
overlap.
.para
First which two contigs are to be joined.
The user should identify the two
contigs. First the left contig and then the right.
The program checks that the two contig numbers are different (it will not
allow circles to be formed!)
.para
Now identify the exact position of overlap. This is defined as
the position in the left contig that the leftmost character of the right
contig overlaps. Normally the position is established by employing the
end gel reading for option "auto assemble".
The overlap must be of at least one character. The program then
displays the join showing all the gel readings overlapping
the join from the left contig, their consensus, all the gel readings
from the right
contig that overlap the join, their consensus and then asterisks to
denote mismatches between the two consensuses. For example:
.lit
1460 1470 1480 1490 1500
56 HINW.100 TCT*GAGCAGTGTGGGCGCTG*CCGG
33 HINW.300 TCT*GAGCAGTGTGGGCGCTGC*CGGGCTCGGAGGG
-25 HINW.090 TCT*GAGCAGTGTGGGCG*T*G*CGGGCTCGGAGGG
19 HINW.123 TCTCGAGCAGTGTGGGCGCTG**CGGGCTCGGAGGGCATGAAGTAGAGCG
CONSENSUS TCTCGAGCAGTGTGGGCGCTG-CCGGGCTCGGAGGGCATGAAGTAGAGCG
-6 HINW.010 TCTCGAGCAGTGTGGGCGCTGCCCGGGCTCGGAGGGCATGAAGTTAGAGC
-3 HINW.007 TGGGCGCTGCCCGGGCTCGGAGGGCATGAAGT*AGAGC
-5 HINW.009 GCTCGGAGGGCATGAAGT*AGAGC
CONSENSUS TCTCGAGCAGTGTGGGCGCTGCCCGGGCTCGGAGGGCATGAAGTTAGAGC
MISMATCH * ******
10 20 30 40 50
.END LIT
.para
It is essential that the user aligns the two contigs throughout the whole
region of overlap before completing the join because it is only at this
stage that the two contigs can be edited independently. Once the join is
completed the alignment can only be altered using the routines supplied
by
"alter relationships". The program offers the user options to facilitate the
alignment of the two contigs. These options are:-
.LEFT MARGIN2
.lit
? = Help
! = Give up
3 = Complete join
4 = Edit left contig
5 = Display joint
6 = Edit right contig
7 = Move join
.end lit
.LEFT MARGIN2
1. Help gives this information.
.LEFT MARGIN2
2. Give up allows the user to return to the main options without
completing the join. Note any edits made will remain.
.LEFT MARGIN2
3. Complete join instructs the program to update the relationships so
that
the two contigs are joined. DO NOT KILL THE PROGRAM DURING COMPLETE
JOIN!
.LEFT MARGIN2
4. Edit left contig and edit right contig give access to a simple editor that
allows insertions,
deletions and changes to be made to the contigs. Help is available on
editing once the editing option is selected. The user is only allowed to
edit within the region of overlap and should make sure that the positions
used correspond to the correct contig.
.LEFT MARGIN2
5. Display join displays the joint as shown above.
.LEFT MARGIN2
6. See above.
.LEFT MARGIN2
7. Move join allows the position of the joint to be changed.
.left margin1
@24. TX 1 @ Copy the database
.LEFT MARGIN2
.PARA
Used to make a copy of the database. If required the database size can be
altered using this option. The "version" of a database is encoded as the
last letter in the names of the three files that contain the database.
.para
Supply a "version" number (the default is version 1), and if required
select a new size for the database. The size of a database is the number
of
lines of information it can hold. It needs a line for each gel reading and
another for each contig.
.left margin1
@19. TX 1 @ Check database
.LEFT MARGIN2
.para
Used to perform a check on the logical consistency of the
database. No user intervention is required.
.para
The following relationships are checked:
.LEFT MARGIN2
1. If gel reading A thinks gel reading B is its left
neighbour
does B think A is
its right neighbour?
The error message is
.left margin2
"Hand holding problem for gel reading A"
.left margin2
followed by the
gel descriptor lines for gel readings A and B.
.LEFT MARGIN2
2. Are there any contig lines with no left or right
end gel readings?
The error message is
.left margin2
"Bad contig line number A"
.LEFT MARGIN2
3. Do the gel readings that are described as left ends on
contig
lines agree that they are left ends?
The error message is
.left margin2
"The end gel readings of contig A have outward neighbours"
.LEFT MARGIN2
4. Are there gel readings that are in more than one contig?
The error message is
.left margin2
" Gel number A is used N times"
.LEFT MARGIN2
5. Are there gel readings that are not in any contig?
The error message is
.left margin2
" Gel number A is not used"
.LEFT MARGIN2
6. Do the relative positions of gel readings agree with
their
position as defined by left and right neighbourliness?
The error message is
.left margin2
" Gel number A with position X is left neighbour of gel number B with
position Y"
.LEFT MARGIN2
7. Are there any loops in contigs? If so no further
checking is done.
The error mesage is
.left margin2
" Loop in contig n no further checking done, but gel reading numbers follow"
.left margin2
The
program then prints the gel reading numbers in the looped
contig up
to
the start of the loop.
.LEFT MARGIN2
8. Are there any contigs of length <1? The error message is
.left margin2
" The contig on line
number x has zero length"
.LEFT MARGIN2
9. Are there any gel readings (used in only one contig) that have zero
length? The error
message is
.left margin2
" Gel number N has zero length"
.left margin2
Note that "auto assemble" also uses this logical consistency check and
will
only tolerate a "Gel number N
is not used" error. Any other error will cause it to
give up.
.left margin1
@29. TX 1 @ Examine quality
.LEFT MARGIN2
.para
Analyses the quality of the data in a contig. It reports on the proportion
of the consensus that is "well determined" and will display a sequence of
symbols that indicate the quality of the consensus at each position.
.para
Identify the contig to analyse, and the section of interest. The current
consensus calculation cutoff score will be used to decide if each position
is
"well determined". In general the quality of a reading deteriorates along
the length of the gel and so it is also possible to use a length cutoff for
the quality calculation. Only the data from the first section of each reading
will be included in the quality calcualtion. The length is altered under
"set parameters" and is initially set to the maximum reading length.
A summary showing the percentage of the consensus
that falls into each category of quality is shown. Choose whether or not to
have the quality codes for each position of the consensus displayed.
They can be displayed as either graphics or text.
.para
The quality of the data depends on the number of times it has been
sequenced and the particular uncertainty codes used in each gel
reading. This function divides the data into five categories, assigning
each
a symbol or code:
.LEFT MARGIN2
1. Well determined on both strands and they agree. code=0
.LEFT MARGIN2
2. Well determined on the plus strand only. code=1
.LEFT MARGIN2
3. Well determined on the minus strand only. code=2
.LEFT MARGIN2
4. Not well determined on either strand. code=3
.LEFT MARGIN2
5. Well determined on both strands but they disagree. code=4
.LEFT MARGIN2
A position is "well determined" if it is assigned one of the symbols
A,C,G,T when the algorithm described in the section "calculate a
consensus".
The calculation is performed
separately for each strand.
.para
If the user chooses to have the data displayed graphically the following
scheme is used. A rectangular box is drawn so that the x coordinate
represents the length of the contig. The box is notionally
divided vertically into
5 possible levels which are given the y values: -2,-1,0,1,2.
The quality codes attributed to each base position are plotted as
rectangles.
Each rectangle represents a region in
which the quality codes are identical, so a single base having a different
code from its immediate neighbours will appear as a very narrow rectangle.
.lit
Rectangle bottom and top y values
Quality 0 rectangle from 0 to 0
Quality 1 rectangle from 0 to 1
Quality 2 rectangle from 0 to -1
Quality 3 rectangle from -1 to 1
Quality 4 rectangle from -2 to 2
.end lit
.para
Obviously a single line at the midheight shows a perfect sequence.
.para
Typical dialogue is shown below.
.lit
41.47% OK on both strands and they agree(0)
55.48% OK on plus strand only(1)
2.08% OK on minus strand only(2)
0.97% Bad on both strands(3)
0.00% OK on both strands but they disagree(4)
? (y/n) (y) Show sequence of codes
10 20 30 40 50
1111111111 1111111111 1111111111 1111111111 1111111111
60 70 80 90 100
1111111111 1111111111 1111111111 3111111111 1111111111
110 120 130 140 150
1111111111 1111131111 1111111111 1111111111 1111111111
160 170 180 190 200
1111111111 1111111111 1111111111 1111111111 1111111133
210 220 230 240 250
1311111111 1111111111 1111111110 0000000000 0000220000
260 270 280 290 300
0000000000 0020000000 2200000202 0002000000 0000222200
.end lit
.left margin1
@26. TX 3 @ Alter relationships
.LEFT MARGIN2
.para
Used to make what are normally illegal changes to the database. That is
the normal checks are not done and any item in the database can be
changed independently of all others. Users need to know what they are
doing because it is very easy to make a horrible mess. Always start by
making a copy!
.para
By using the options here users can edit individual gel readings in contigs,
move one section of a contig relative to another, break contigs, remove
contigs, remove gel readings, etc. To give flexibility most
of the commands do only one thing. This means that several commands
may
have to be executed to complete any change. At the end of this help
section
there are notes on removing gel readings from the database.
.para
The following options are offered:
.lit
? = HELP
! = QUIT
3 = Line change
4 = Edit single gel reading
5 = Delete contig
6 = Shift
7 = Move gel reading
8 = Rename gel reading
9 = Break a contig
.end lit
.left margin2
1. HELP gives this information.
.left margin2
2. QUIT returns to the main options of SAP.
.left margin2
3. Line change
.left margin2
allows the user to change the contents of any line in the
file of relationships. The line is selected by number, the
program prints the current line and prompts for the new line.
.left margin2
4. Edit
.left margin2
allows the user to edit an individual gel reading
independently of any others it may be related to. The edit
positions are relative to
the contig. The effect of this editing on the length of the
gel reading is taken care of but, if it changes the length of
a contig,
or its relationship to others, this must be accounted for (if
necessary) by use of the "line change" function.
.left margin2
5. Delete contig
.left margin2
is a function that deletes a contig line by moving down
all the contig lines above by one position. It prompts only
for the line to delete. It does not delete any of the gel
readings
or gel reading
lines for the deleted contig but it does reduce the
number of contigs on line IDBSIZ by 1.
.left margin2
6. Shift
.left margin2
allows the user to change all the relative positions of a
set of neighbouring gel
readings by some fixed value, i.e. it will
shift related gel readings
either left or right. It can therefore
be used to change the alignment of the gel
readings in a contig
or as part of the process of breaking a contig into two parts
(see below). It prompts for the number of the first gel
reading to
shift and then for the distance to move them (Note a
negative value will move the gel readings
left and a positive value
right). It then chains rightwards (ie follows right
neighbours) and shifts each gel
reading, in turn, up to the end
of the contig. (This means that only those gel readings
from the first
to shift to the rightmost are moved). It updates the length of
the contig accordingly.
.left margin2
7. Move gel reading
.left margin2
is a function to renumber a gel reading. It moves all the information
about a gel
reading on to another line. The user must specify the
number
of the gel reading
to move and the number of the line to place it. It
takes care of all the relationships. Of course gel
readings must not be
moved to lines occupied by other gel
readings! It can be used as part
of the process of removing a gel
reading from the database (see below).
.left margin2
8. Rename gel reading
.left margin2
is a function that is used to rename the archive names of
gel
readings in the database; it only changes the name in the .ARN
file of the database.
.sk1
.LEFT MARGIN2
9. Break contig
.LEFT MARGIN2
.PARA
Occasionaly it is necessary to break a contig into two parts and this can be
achieved using this option. The program needs only the number of a gel
reading. This is the gel reading that will become a left end after the
break. That
is, the break is made between this gel
reading and its left neighbour. A new contig
line is created so ensure that there is sufficient space in the database.
.left margin2
Removing gel readings from contigs
.left margin2
.PARA
Gel
readings can be removed from contigs if they are not essential for holding the
contig together (ie are not the only gel reading covering a particular region).
Suppose the gel reading to remove is gel number
b with left neighbour a and right
neighbour c.
Using "line change" change the right neighbour of a to c, and the left
neighbour of c to a. To tidy things up: suppose there are x gel
readings in the
database; then, using "move gel reading" move gel x to line b; then, using
"line change"
decrease the number of gel
readings in the database (stored in the last line) by 1.
.left margin1
@27. TX 1 @ Set display parameters
.LEFT MARGIN2
.para
Used to redefine the parameters that control the cutoff employed by the
consensus calculation and quality examiner, the maximum length of each
reading to include in the quality calculation, the line length used by
the display function, the text window length used by the graphics
options, and the graphics window length used by the graphics options.
.para
The default cutoff score is 75%. The default line length is 50 characters.
For protein sequences the cutoff is always 100%.
.para
The text window used by the graphics options controls the amount of
sequence listed at the crosshair position. The graphics window controls the
"zoom" function. Both these windows are defined as the number of bases that
should be shown, to both left and right of the crosshair.
.left margin1
@30. TX 3 @ Auto edit a contig
.left margin2
.para
This function automatically changes characters in gel readings to make
them agree with the consensus sequence. If employed as is intended, use
of this function is not a criminal activity but a method that saves a large
amount of work. All characters changed by the auto editor will appear in
the gel readings as lowercase letters. The current consensus calculation
cutoff score is used.
.para
Identify the contig and the section to edit. The program will display a
summary of changes made. Note that it is important to understand both
what the auto editor does and the order in which it does it. Before
employing the auto editor users should note all the corrections that they
require, so that after it has been used the corrections can be checked.
.para
The
general strategy employed when collecting shotgun sequence data is to let
the contigs get fairly deep, to get a printout of a contig,
check problems against the
films, note corrections on the printout, and
make the changes using an interactive editor.
In general the consensus is correct except for places where padding
characters have been used to accommodate a single gel with an extra
character, or where the consensus is dash. The important point for the
auto
editor is that
most edits simply make the
gel readings conform to the consensus, or remove columns of pads.
.para
The new editor does the following.
.para
1) calculates a consensus for the contig (or part of a contig) to be
edited, and then uses this consensus to direct the editing of the contig
in 3 stages
.para
2) stage 1: find and correct all places where, if the order of two adjacent
characters is swapped, they will both agree with the consensus (given
that
they did not match the consensus before). These corrections are termed
"transpositions"
.para
3) stage 2: find and correct all places where there is a definite consensus
but the gel reading has a different character. These corrections are
termed
"changes".
.para
4) stage 3: delete all positions in which padding is the consensus. These
corrections are termed "deletions".
.para
All changed characters are shown in lowercase letters so it will be
obvious which
characters have been assigned by the program (except for deletions). The
number of each type of correction will be displayed.
.LEFT MARGIN1
@10. TX 2 @Clear graphics
.LEFT MARGIN2
.para
Clears graphics from the screen.
.left margin1
@11. TX 2 @Clear text
.LEFT MARGIN1
.para
Clears text from the screen.
.left margin1
@12. TX 2 @Draw a ruler.
.LEFT MARGIN2
.para
This option
allows the user to draw a ruler or scale along the x axis of the screen to
help identify the coordinates of points of interest. The user can define
the position of the first base to be marked (for example if the active
region is 1501 to 8000, the user might wish to mark every 1000th base
starting at either 1501 or 2000 - it depends if the user wishes to treat
the active region as an independent unit with its own numbering starting
at
its left edge, or as part of the whole sequence). The user can also define
the separation of the ticks on the scale and their height. If required the
labelling routine can be used to add numbers to the ticks.
.left margin1
@14. TX 2 @Reposition plots
.LEFT MARGIN2
.para
The positions of each of the plots is defined relative to a users drawing
board which has size 1-10,000 in x and 1-10,000 in y.
Plots for
each option are drawn in a window defined by x0,y0 and xlength,ylength.
Where x0,y0 is the position of the bottom left hand corner of the window,
and xlength is the width of the window and ylength the
height of the window.
.lit
--------------------------------------------------------- 10,000
1 1
1 -------------------------------------- ^ 1
1 1 1 1 1
1 1 1 1 1
1 1 1 ylength 1
1 1 1 1 1
1 1 1 1 1
1 -------------------------------------- v 1
1 x0,y0^ 1
1 <---------------xlength--------------> 1
--------------------------------------------------------- 1
1 10,000
.end lit
All values are in drawing board units (i.e. 1-10,000, 1-10,000).
The default window positions are read from a file "ANALMARG" when the
program is started. Users can have their own file if required.
As all the plots start
at the same position in x and have the same width, x0 and xlength are the
same for all options. Generally users will only want to change the start
level of the window y0 and its height ylength.
This option
allows users to change window positions whilst running the program.
The routine prompts first for the number of the option that the users
wishes
to reposition; then for the y start and height; then for the x start and
length. Note that changes to the x values affect all options. If the user
types only carriage return for any value it will remain unchanged.
Note that, unlike all the other programs, the boxes used to contain
analytical results (eg plot quality) should not be made to overlap one
another, as the function of the crosshair routine depends on which box the
crosshair is in!
overlap
.LEFT MARGIN1
@15. TX 2 @Label a diagram
.LEFT MARGIN2
.para
This routine allows users to label any diagrams they have produced. They
are asked to type in a label. When the user types carriage return to finish
typing the label the cross-hair appears on the screen. The user can
position it anywhere on the screen. If the user types R (for right justify)
the label will be
written on the diagram with its right end at the cross-hair position.
If the user types L (for left justify) the label will be written on the
diagram with its left end at the cross hair position.
The
cross-hair will then immediately reappear. The user may put the same
label
on another part of the diagram as before or if he hits the space bar he
will be asked if he wishes to type in another label.
.para
Typical dialogue follows.
.lit
? Menu or option number=15
Type label then drive cross hair to left or right end
of label position then hit "L" to write label left
justified or "R" to write label right justified or
the space bar to quit
? Label=delta gene
missing graphics
? Label=
.end lit
.left margin1
@16. TX 2 @Display a map.
.LEFT MARGIN2
.para
This draws a map
of any sequence features selected by the user.
These features may be protein coding regions (CDS), tRNA genes (TRNA),
promoter positions (PRM), etc. Users may define their own feature table
key
names. For example I find it convenient to split CDS lines into CDS1,
CDS2
and CDS3 each of which contains only those sequences that code in the
reading frames 1, 2 or 3. Then I can plot them at different heights on
the screen ( suitable heights can be determined by using the cross-hair).
The coordinates must be stored in a file in the format of an EMBL feature
table.
.para
Typical dialogue follows.
.lit
? Menu or option number=16
Display a map using an EMBL feature table file
? map file name=hsegl1.ft
? feature code(e.g. CDS) =CDS
X 1 + strand
2 - strand
3 both strands
? 0,1,2,3 =
? level (0-9480) (256) =4000
missing graphics
? feature code(e.g. CDS) =
.end lit
.left margin1
@7. TX 1 @Redirect output
.LEFT MARGIN2
.para
Used to direct output that would normally appear on the screen to a file.
.para
Select redirection of either text or graphics, and
supply the name of the file that the output should be written to.
.para
The results from the next options selected will not appear on the screen
but will be written to the file. When option 7 is selected again
the file will be
closed and output will again appear on the screen.
.left margin1
@13. TX 2 @Use crosshair
.left margin2
This option puts a steerable cross on the screen which the user
drives around
by using the arrow keys (or mouse). When the crosshair is
visible a number of options are available if the user types one of a
set of special keyboard characters. Any other characters will cause
an exit from the crosshair option. The special keys are:
.lit
I = Identify the nearest gel reading
Z = Zoom in
Q = plot Quality
S = display the aligned Sequences at the crosshair position
N = list the Names and Numbers of the sequences at the crosshair
.end lit
.para
In order for any of these special keys to operate, the crosshair
must be in an appropriate display box, and the precise function of
the keys will also depend on which box the crosshair is in.
.para
If the
crosshair is in the "plot all contigs" box, Z will cause a new box to
appear showing all the readings for the nearest contig; Q will give
the same as Z but will also produce an extra box showing the
"quality" plot.
.para
If Z is hit in the "plot single contig" box, the contig will be zoomed
to the current graphics window size. The zoom will be roughly
centred on the crosshair position. Because of this it is possible to
step along a contig by repeatedly zooming with the crosshair near
to one end of the single contig display box. If I is hit the crosshair
must be close to a gel reading line. If Q is hit, the quality plot will
be produced for the region shown in the plot single contig box. In
all cases when the "plot all contigs" box is shown, a vertical line will
bisect the line the represents the relevent contig, at the current
position.
.para
If the crosshair is in the plot quality box only the character "s" will operate
as a special symbol.
.para
The number of bases shown in the N and S options is controlled by
the current graphics text window size, and the size of the zoom
window by the current graphics window size. Both are set by the
parameter setting function of the general menu.
.left margin1
@33. TX 2 @Plot single contig
.left margin2
This option produces a schematic of a selected region of a single
contig by drawing a horizontal line to represent each of its gel
readings. The lines show the relative positions of each reading and
also their sense. The plot is divided vertically into two sections by
a line that is identified by an asterisk drawn at each end. All lines
that lie above this line represent readings that are in their original
sense, all lines below show readings that are in the
complementary sense to their original. By use of the crosshair
function the plot can be stepped through and examined in more
detail. See help on crosshair.
.left margin1
@34. TX 2 @Plot all contigs
.left margin2
This option produces a schematic of all the contigs in a database. It
does this by drawing a horizontal line to represent each of them.
In order to show the ends of each contig it draws the lines for
contigs at alternate heights: the first at height one, the
second at height two, the third at height one, etc. The order of the
contigs in the display is the same as their order in the database.
By use of the crosshair function the plot can be stepped
through and examined in more detail. See help on crosshair.
.left margin1
@31. TX 3 @ Type in gel readings
.left margin2
This option allows gel readings to be typed in at the keyboard. It creates
a separate file for each gel reading and a file of file names for the
batch. The sequences from each batch may be listed when they have all been
entered. Users may choose to employ special keys to identify the 4 bases
A,C,G and T. By default these special keys are N M , . but any other four
characters may be used. If special keys are used the characters are
automatically translated to A C G T before being stored on the disk.
.left margin1
@35. TX 1 @ Find internal joins
.left margin2
The purpose of this function is to use data already in the database to
find possible joins between contigs.
Joins may have been missed due to poor data or may have not been made
due to repeated sequences. Where appropriate, it may be
possible to find potential
joins by using the data clipped off readings prior to their entry into the
database.
.left margin2
The database is checked for logical consistency. Supply a minimum initial
match length, a minimum alignment block, the maximum pads per sequence,
the maximum percent mismatch after alignment, the probe length. Choose
if clipped data is to be used, if so define the window size for finding good
data and the number of dashes allowed in the window. Processing will commence.
Most of these values are used in an identical way in the autoassemble
function. The others are defined below.
.left margin2
The program strategy
.left margin2
Take the first contig and calculate its consensus. If clipped data is being
used examine all readings that
are in the complementary orientation, and sufficiently near to the contigs left
end, to see if they have good clipped sequence which if present, would
protrude
from the left end of the contig. If found add the longest such sequence to the
left end of the consensus. Do the same for the right end by examining
readings that are in their
original orientation. If any are found add the longest extension to the
right end of
the consensus. Repeat the consensus calculations and extensions
for all contigs hence producing an extended consensus. If clipped data is not
being used simply calculate the consensus for the whole database. Now
look for possible joins by processing the extended consensus in the following
way. Take the last, say 100, bases (termed the "probe length" by the program)
of the rightmost consensus, compare it both
orientations with the extended consensus of all the other contigs. Display
any sufficiently good alignments. Repeat with the left end of the rightmost
contig. Do the same for the ends of all the entended contigs, always only
comparing with the contigs to their left, so that the same matches do not
appear twice.
.left margin2
Good cliped data is defined by sliding a window of "Window size for good data
scan" bases outwards
along the sequence and stopping when "Maximum number of dashes in scan window"
or more dashes appear in the window.
Note that
it is advisable to have some sort of cutoff because if we simply take all the
data it might be so full of rubbish that we wont find any good matches. For
the same reason it is worth trying the procedure with different cutoffs. An
initial run using no clipped data is also recommended.
Sufficiently good
alignments are defined by criteria equivalent to those used in autoassemble,
however here we only display alignments that pass all tests.
.left margin2
Bugs
.left margin2
If a small contig is wholly contained within a larger one, such that its
ends are further than ("Probe length" - "Minimum initial match length")
from the ends of the larger contig, and the consensus for the small
contig lies to the left
of the consensus for large contig, the overlap will not be discovered. (See
the search stratgey).
.left margin2
All numbering is
relative to base number one in the contig: matches to the left (i.e. in
the clipped data) have negative
positions, matches off the right end of the contig (i.e. in the clipped
data) have positions
greater than that of the contig length. A typical result is shown below.
.lit
Right end of contig 22 in the - sense and contig 96
Percentage mismatch after alignment = 3.0
628 638 648 658 668 678
GTGAGATGAG CATATTTAAA ATGAACCGAG CAGTTAGGAG ATATGTTGGG AGGACAAGAA
********* ********** ********** ********** ********** **********
-TGAGATGAG CATATTTAAA ATGAACCGAG CAGTTAGGAG ATATGTTGGG AGGACAAGAA
-86 -76 -66 -56 -46 -36
688 698 708 718
ACATCCGGGA TACAGTCAAT AAATGAAAAA TTAATGAATT
********** ********** ****** *** ***** ****
ACATCCGGGA TACAGTCAAT AAATGA-AAA TTAATTAATT
-26 -16 -6 4
.end lit