2023-04-16 13:07:57 +08:00

981 lines
38 KiB
Raw Blame History

||||||||||| ReadSeq supported formats (revised 30Dec92)
-f[ormat=]Name Format name for output:
1. IG/Stanford 10. Olsen (in-only)
2. GenBank/GB 11. Phylip3.2
3. NBRF 12. Phylip
4. EMBL 13. Plain/Raw
6. DNAStrider 15. MSF
7. Fitch 16. ASN.1
8. Pearson/Fasta 17. PAUP
9. Zuker (in-only) 18. Pretty (out-only)
In general, output supports only minimal subsets of each format
needed for sequence data exchanges. Features, descriptions
and other format-unique information is discarded.
Users of Olsen multi sequence editor (VMS). The Olsen format
here is produced with the print command:
Use Genbank output from readseq to produce a format that this
editor can read, and use the command
load/genbank some.file
Dan Davison has a VMS program that will convert to/from the
Olsen native binary data format. E-mail
Warning: Phylip format input is now supported (30Dec92), however the
auto-detection of Phylip format is very probabilistic and messy,
especially distinguishing sequential from interleaved versions. It
is not recommended that one use readseq to convert files from Phylip
format to others unless essential.
||||||||||| ReadSeq usage (revised 11Nov91)
A. determine file format:
short skiplines; /* result: number of header lines to skip (or 0) */
short error; /* error result or 0 */
short format; /* resulting format code, see ureadseq.h */
char *filename = "Mysequence.file"
format = seqFileFormat( filename, &skiplines, &error);
if (error!=0) fail;
B. read number and list of sequences (optional)
short numseqs; /* resulting number of sequences found in file */
char *seqlist; /* list of sequence names, newline separated, 0 terminated */
seqlist = listSeqs( filename, skiplines, format, &numseqs, &error);
if (error!=0) display (seqlist);
free( seqlist);
C. read individual sequences as desired
short seqIndex; /* sequence index #, or == kListSeqs for listSeqs equivalent */
long seqlen; /* length of seq */
char seqid[256]; /* sequence name */
char *seq; /* sequence, 0 terminated, free when done */
seq = readSeq( seqIndex, filename, skiplines, format,
&seqlen, &numseqs, &error, seqid);
if (error!=0) manipulate(seq);
D. write sequences as desired
int nlines; /* number of lines of sequence written */
FILE* fout; /* open file pointer (stdout or other) */
short outform; /* output format, see ureadseq.h */
nlines = writeSeq( fout, seq, seqlen, format, outform, seqid);
Note (30Dec92): There is various processing done by the main program (in readseq.c),
rather than just in the subroutines (in ureadseq.c). Especially for interleaved
output formats, the writeSeq subroutine does not handle interleaving, nor some of
the formatting at the top and end of output files. While seqFileFormat, listSeqs,
and readSeq subroutines are fairly self-contained, the writeSeq depends a lot on
auxilliary processing. At some point, this may be revised so writeSeq is self-
Note 2: The NCBI toolkit (ftp from is needed for the ASN.1 format
reading (see ureadasn.c). A bastard (but workable I hope) ASN.1 format is written
by writeSeq alone.
||||||||||| sequence formats....
seq1 info
efgh1 (or 2 = terminator)
;another seq
seq2 info
--- for e.g. ----
; Dro5s-T.Seq Length: 120 April 6, 1989 21:22 Check: 9487 ..
; TOIG of: Dro5srna.Seq check: 9487 from: 1 to: 120
LOCUS seq1 ID..
123456789abcdefg....(1st 9 columns are formatting)
// (end of sequence)
LOCUS seq2 ID ..
NBRF format: (from uwgcg ToNBRF)
Iubio$Dua0:[Gilbertd.Gcg]Dro5srna.Seq;2 => DRO5SRNA
EMBL format
ID345 seq1 id (the 345 are spaces)
... other info
SQ345Sequence (the 3,4,5 are spaces)
// (! this is proper end string: 12Oct90)
ID seq2 id
SQ Sequence
UW GCG Format:
comments of any form, up to ".." signal
signal line has seq id, and " Check: #### .."
only 1 seq/file
-- e.g. --- (GCG from GenBank)
LOCUS DROEST6 1819 bp ss-mRNA INV 31-AUG-1987
... much more ...
ORIGIN 1 bp upstream of EcoRI site; chromosome BK9 region 69A1.
INVERTEBRATE:DROEST6 Length: 1819 January 9, 1989 16:48 Check: 8008 ..
DNAStrider (Mac) = modified Stanford:
; ### from DNA Strider Friday, April 7, 1989 11:04:24 PM
; DNA sequence pBR322 4363 b.p. complete sequence
// (end of sequence)
Fitch format:
W.Pearson/Fasta format:
>BOVPRL GenBank entry BOVPRL from omam file. 907 nucleotides.
Phylip version 3.2 format (e.g., DNAML):
5 13 YF (# seqs, #bases, YF)
aaaagggccc... (continued sp. alpha)
aaaagggccc... (continued sp. beta)
aaaagggccc... (continued sp. Gamma)
1234567890^-- bases must start in col 11, and run 'til #bases
(spaces & newlines are okay)
Phylip version 3.3 format (e.g., DNAML):
5 42 YF (# seqs, #bases, YF)
1234567890^-- bases must start in col 11
!! this version interleaves the species -- contrary to
all other output formats.
Phylip version 3.4 format (e.g., DNAML)
-- Both Interleaved and sequential are permitted
5 13 (# seqs, #bases)
aaaagggccc... (continued sp. alpha)
aaaagggccc... (continued sp. beta)
aaaagggccc... (continued sp. Gamma)
1234567890^-- bases must start in col 11, and run 'til #bases
(spaces, newlines and numbers are are ignored)
Gary Olsen (multiple) sequence editor /print format:
!17Oct91 -- error in original copy of olsen /print format, shifted right 1 space
! here is correct copy:
301 40 Tb.thiop CGCAGCGAAA----------GCUNUGCUAAUACCGCAUA-CGnCCUG----------------------------------------------------- Tb.thiop
301 42 Rhc.purp CGUAGCGAAA----------GUUACGCUAAUACCGCAUA-UUCUGUG----------------------------------------------------- Rhc.purp
301 44 Rhc.gela nnngnCGAAA----------GCCGGAUUAAUACCGCAUA-CGACCUA----------------------------------------------------- Rhc.gela
RNase P RNA components. on 20-FEB-90 17:23:58
1 (E.c. pr ): Base pairing in Escherichia coli RNase P RNA.
2 (chrom ): Chromatium
12 (B.brevis): Bacillus brevis RNase P RNA, B. James.
13 ( 90% con): 90% conserved
14 (100% con): 100% conserved
15 (gram+ pr): pairing
RNase P RNA components. on 20-FEB-90 17:23:58
Posi- Sequence
tion: identity: Data:
1 1 E.c. pr <<<<<<<<<< {{{{{{{{<<:<<<<<<<<<<^<<<<<<====>>>> E.c. pr
1 2 chrom GGAGUCGGCCAGACAGUCGCUUCCGUCCU------------------ chrom
1234567890123456789012 <! this should be 21 not 22,
! this example must be inset on left by 1 space from olsen /print files !
1 13 90% con G C G A CGC GC - - 90% con
1 14 100% con G A CGC 100% con
1 15 gram+ pr <<<<<<<<<< {{{{{{{{<<<<<<<<<<<<<=============== gram+ pr
60 1 E.c. pr >>>>>>^>>^>>>>:>> <<<^<<<< {{{{{ E.c. pr
60 2 chrom -----GGUG-ACGGGGGAGGAAAGUCCGG-GCUCCAU------------- chrom
: :
GCG MSF format
Title line
picorna.msf MSF: 100 Type: P January 17, 1991 17:53 Check: 541
Name: Cb3 Len: 100 Check: 7009 Weight: 1.00
Name: E Len: 100 Check: 60 Weight: 1.00
1 50
Cb3 ...gpvedai .......t.. aaigr..vad tvgtgptnse aipaltaaet
E gvenae.kgv tentna.tad fvaqpvylpe .nqt...... kv.affynrs
51 100
Cb3 ghtsqvvpgd tmqtrhvkny hsrsestien flcrsacvyf teykn.....
E ...spi.gaf tvks...... gs.lesgfap sviltpgpqf
PIR format
This is NBRF-PIR MAILSERVER version 1.45
Command-> get PIR3:A31391
ENTRY A31391 #Type Protein
TITLE *Esterase-6 - Fruit fly (Drosophila melanogaster)
DATE 03-Aug-1992 #Sequence 03-Aug-1992 #Text 03-Aug-1992
PLACEMENT 0.0 0.0 0.0 0.0 0.0
COMMENT *This entry is not verified.
SOURCE Drosophila melanogaster
#Authors Cooke P.H., Oakeshott J.G.
#Citation submitted to GenBank, April 1989
#Reference-number A31391
#Accession A31391
#Cross-reference GB:J04167
SUMMARY #Molecular-weight 61125 #Length 544 #Checksum 1679
5 10 15 20 25 30
1 M N Y V G L G L I I V L S C L W L G S N A S D T D D P L L V
31 Q L P Q G K L R G R D N G S Y Y S Y E S I P Y A E P P T G D
61 L R F E A P E P Y K Q K W S D I F D A T K T P V A C L Q W D
91 Q F T P G A N K L V G E E D C L T V S V Y K P K N S K R N S
121 F P V V A H I H G G A F M F G A A W Q N G H E N V M R E G K
151 F I L V K I S Y R L G P L G F V S T G D R D L P G N Y G L K
181 D Q R L A L K W I K Q N I A S F G G E P Q N V L L V G H S A
211 G G A S V H L Q M L R E D F G Q L A R A A F S F S G N A L D
241 P W V I Q K G A R G R A F E L G R N V G C E S A E D S T S L
271 K K C L K S K P A S E L V T A V R K F L I F S Y V P F A P F
301 S P V L E P S D A P D A I I T Q D P R D V I K S G K F G Q V
331 P W A V S Y V T E D G G Y N A A L L L K E R K S G I V I D D
361 L N E R W L E L A P Y L L F Y R D T K T K K D M D D Y S R K
391 I K Q E Y I G N Q R F D I E S Y S E L Q R L F T D I L F K N
421 S T Q E S L D L H R K Y G K S P A Y A Y V Y D N P A E K G I
451 A Q V L A N R T D Y D F G T V H G D D Y F L I F E N F V R D
481 V E M R P D E Q I I S R N F I N M L A D F A S S D N G S L K
511 Y G E C D F K D N V G S E K F Q L L A I Y I D G C Q N R Q H
541 V E F P
PAUP format:
The NEXUS Format
Every block starts with "BEGIN blockname;" and ends with "END;".
Each block is composed of one or more statements, each
terminated by a semicolon (;).
Comments may be included in NEXUS files by enclosing them within
square brackets, as in "[This is a comment]."
NEXUS-conforming files are identified by a "#NEXUS" directive at
the very beginning of the file (line 1, column 1). If the
#NEXUS is omitted PAUP issues a warning but continues
NEXUS files are entirely free-format. Blanks, tabs, and
newlines may be placed anywhere in the file. Unless RESPECTCASE
is requested, commands and data may be entered in upper case,
lower case, or a mixture of upper and lower case.
The following conventions are used in the syntax descriptions of
the various blocks. Upper-case items are entered exactly as
shown. Lower-case items inside of angle brackets -- e.g., <x>
-- represent items to be substituted by the user. Items inside
of square brackets -- e.g., [X] -- are optional. Items inside
of curly braces and separated by vertical bars -- e.g., { X | Y
| Z } -- are mutually exclusive options.
The DATA Block
The DATA block contains the data matrix and other associated
information. Its syntax is:
DIMENSIONS NTAX=<number of taxa> NCHAR=<number of characters>;
[ FORMAT [ MISSING=<missing-symbol> ]
[ SYMBOLS="<symbols-list>" ]
[ MATCHCHAR=<match-symbol> ]
[ EQUATE="<symbol>=<expansion> [<symbol>=<expansion>...]" ]
[ ZAP = "<list of zapped characters>" ] ; ]
[ CHARLABELS <label_1> label_2><3E><> <label_NCHAR> ; ]
[ TAXLABELS <label1_1> <label1_2> <label1_NTAX> ; ]
[ STATELABELS <currently ignored by PAUP> ; ]
MATRIX <data-matrix> ;
--- example PAUP file
[!Brown et al. (1982) primate mitochondrial DNA]
begin data;
dimensions ntax=5 nchar=896;
format datatype=dna matchchar=. interleave missing='-';
[ 2 4 6 8 ]
[ 1 1 1 1 1 ]
human aagcttcaccggcgcagtca ttctcataatcgcccacggR cttacatcctcattactatt ctgcctagcaaactcaaact acgaacgcactcacagtcgc
chimp ................a.t. .c.................a ...............t.... ..................t. .t........c.........
gorilla ....t.....t........a ........a......t.... .................... .......a..c.....c...
orang cc.....g..t.....t..a .................... .......a..c.....c...
gibbon .c.................a ......t............. .......a........c...
[ 8 8 8 8 8 8 ]
[ 0 2 4 6 8 9 ]
[ 1 1 1 1 1 6 ]
human cttccccacaacaatattca tgtgcctagaccaagaagtt attatctcgaactgacactg agccacaacccaaacaaccc agctctccctaagctt
chimp t................... .a................c. ........a.....g..... ...a................ ................
gorilla .a................c. ........a.g......... .a..............
orang ta....a...........t. .a.a..c.....g...cta. .a.....a........
gibbon a..t.......t........ .....t..a........... .a..............
||||||||||| Sample SMTP mail header
- - - - - - - - -
From Sun Nov 10 17:28:56 1991
Received: from by
(4.1/9.5jsm) id AA19328; Sun, 10 Nov 91 17:28:55 EST
Received: by (5.65/IG-2.0)
id AA14458; Sun, 10 Nov 91 14:30:03 -0800
Date: Sun, 10 Nov 91 14:30:03 -0800
Message-Id: <>
From: Database Server <>
Subject: Results of Query for drorna
Status: R
No matches on drorna.
- - - - - -
From Sun Nov 10 17:28:49 1991
Received: from by
(4.1/9.5jsm) id AA19323; Sun, 10 Nov 91 17:28:47 EST
Received: by (5.65/IG-2.0)
id AA14461; Sun, 10 Nov 91 14:30:03 -0800
Date: Sun, 10 Nov 91 14:30:03 -0800
Message-Id: <>
From: Database Server <>
Subject: Results of Query for droest6
Status: R
LOCUS DROEST6 1819 bp ss-mRNA INV 31-AUG-1987
DEFINITION D.melanogaster esterase-6 mRNA, complete cds.
||||||||||| GCG manual discussion of sequence symbols:
GCG programs allow all upper and lower case letters, periods (.),
asterisks (*), pluses (+), ampersands (&), and ats (@) as symbols in
biological sequences. Nucleotide symbols, their complements, and the
standard one-letter amino acid symbols are shown below in separate lists.
The meanings of the symbols +, &, and @ have not been assigned at this
writing (March, 1989).
GCG uses the letter codes for amino acid codes and nucleotide
ambiguity proposed by IUB (Nomenclature Committee, 1985,
Eur. J. Biochem. 150; 1-5). These codes are compatible with the codes
used by the EMBL, GenBank, and NBRF data libraries.
The meaning of each symbol, its complement, and the Cambridge and
Stanford equivalents are shown below. Cambridge files can be converted
into GCG files and vice versa with the programs FROMSTADEN and TOSTADEN.
IntelliGenetics sequence files can be interconverted with the programs
IUB/GCG Meaning Complement Staden/Sanger Stanford
M A or C K 5 J
R A or G Y R R
W A or T W 7 L
S C or G S 8 M
Y C or T R Y Y
K G or T M 6 K
V A or C or G B not supported N
H A or C or T D not supported N
D A or G or T H not supported N
B C or G or T V not supported N
X/N G or A or T or C X -/X N
. not G or A or T or C . not supported ?
The frame ambiguity codes used by Staden are not supported by GCG
and are translated by FROMSTADEN as the lower case single base
Staden Code Meaning GCG
D C or CC c
V T or TT t
B A or AA a
H G or GG g
K C or CX c
L T or TX t
M A or AX a
N G or GX g
Here is a list of the standard one-letter amino acid codes and their
three-letter equivalents. The synonymous codons and their depiction in
the IUB codes are shown. You should recognize that the codons following
semicolons (;) are not sufficiently specific to define a single amino
acid even though they represent the best possible back translation into
the IUB codes! All of the relationships in this list can be redefined by
the user in a local data file described below.
Symbol 3-letter Meaning Codons Depiction
B Asp,Asn Aspartic,
C Cys Cysteine TGT,TGC !TGY
D Asp Aspartic GAT,GAC !GAY
E Glu Glutamic GAA,GAG !GAR
F Phe Phenylalanine TTT,TTC !TTY
H His Histidine CAT,CAC !CAY
I Ile Isoleucine ATT,ATC,ATA !ATH
K Lys Lysine AAA,AAG !AAR
M Met Methionine ATG !ATG
N Asn Asparagine AAT,AAC !AAY
Q Gln Glutamine CAA,CAG !CAR
T Thr Threonine ACT,ACC,ACA,ACG !ACX
W Trp Tryptophan TGG !TGG
X Xxx Unknown !XXX
Y Tyr Tyrosine TAT, TAC !TAY
Z Glu,Gln Glutamic,
* End Terminator TAA, TAG, TGA !TAR,TRA;TRR
||||||||||| docs from PSC on sequence formats:
Nucleic Acid and Protein Sequence File Formats
It will probably save you some time if you have your data in a usable
format before you send it to us. However, we do have the University of
Wisconsin Genetics Computing Group programs running on our VAXen and
this package includes several reformatting utilities. Our programs
usually recognize any of several standard formats, including GenBank,
EMBL, NBRF, and MolGen/Stanford. For the purposes of annotating an
analysis we find the GenBank and EMBL formats most useful, particularly
if you have already received an accession number from one of these
organizations for your sequence.
Our programs do not require that all of the line types available in
GenBank, EMBL, or NBRF file formats be present for the file format to
be recognized and processed. The following pages outline the essential
details required for correct processing of files by our programs.
Additional information may be present but will generally be ignored.
GenBank File Format
File Header
1. The first line in the file must have "GENETIC SEQUENCE DATA BANK"
in spaces 20 through 46 (see LINE 1, below).
2. The next 8 lines may contain arbitrary text. They are ignored but
are required to maintain the GenBank format (see LINE 2 - LINE 9).
Sequence Data Entries
3. Each sequence entry in the file should have the following format.
a) first line: Must have LOCUS in the first 5 spaces. The
genetic locus name or identifier must be in spaces
13 - 22. The length of the sequences is right
justified in spaces 23 through 29 (see LINE 10).
b) second line: Must have DEFINITION in the first 10 spaces.
Spaces 13 - 80 are free form text to identify the
sequence (see LINE 11).
c) third line: Must have ACCESSION in the first 9 spaces. Spaces
13 - 18 must hold the primary accession number
(see LINE 12).
d) fourth line: Must have ORIGIN in the first 6 spaces. Nothing
else is required on this line, it indicates that
the nucleic acid sequence begins on the next line
(see LINE 13).
e) fifth line: Begins the nucleotide sequence. The first 9
spaces of each sequence line may either be blank
or may contain the position in the sequence of the
first nucleotide on the line. The next 66 spaces
hold the nucleotide sequence in six blocks of ten
nucleotides. Each of the six blocks begins with a
blank space followed by ten nucleotides. Thus the
first nucleotide is in space eleven of the line while
the last is in space 75 (see LINE 14, LINE 15).
f) last line: Must have // in the first 2 spaces to indicate
termination of the sequence (see LINE 16).
NOTE: Multiple sequences may appear in each file. To begin another
sequence go back to a) and start again.
Example GenBank file
LINE 2 :
LINE 3 :
LINE 4 :
LINE 5 :
LINE 6 :
LINE 7 :
LINE 8 :
LINE 9 :
LINE 10 :LOCUS L_Name Length BP
LINE 11 :DEFINITION Describe the sequence any way you want
LINE 12 :ACCESSION Accession Number
LINE 14 : 1 acgtacgtac gtacgtacgt acgtacgtac gtacgtacgt a...
LINE 15 : 61 acgt...
LINE 16 ://
EMBL File Format
Unlike the GenBank file format the EMBL file format does not require
a series of header lines. Thus the first line in the file begins
the first sequence entry of the file.
1. The first line of each sequence entry contains the two letters ID
in the first two spaces. This is followed by the EMBL identifier
in spaces 6 through 14. (See LINE 1).
2. The second line of each sequence entry has the two letters AC in
the first two spaces. This is followed by the accession number in
spaces 6 through 11. (See LINE 2).
3. The third line of each sequence entry has the two letters DE in the
first two spaces. This is followed by a free form text definition
in spaces 6 through 72. (See LINE 3).
4. The fourth line in each sequence entry has the two letters SQ in
the first two spaces. This is followed by the length of the
sequence beginning at or after space 13. After the sequence length
there is a blank space and the two letters BP. (See LINE 4).
5. The nucleotide sequence begins on the fifth line of the sequence
entry. Each line of sequence begins with four blank spaces. The
next 66 spaces hold the nucleotide sequence in six blocks of ten
nucleotides. Each of the six blocks begins with a blank space
followed by ten nucleotides. Thus the first nucleotide is in space
6 of the line while the last is in space 70. (See LINE 5 -
LINE 6).
6. The last line of each sequence entry in the file is a terminator
line which has the two characters // in the first two spaces.
(See LINE 7).
7. Multiple sequences may appear in each file. To begin another
sequence go back to item 1 and start again.
Example EMBL file
LINE 1 :ID ID_name
LINE 2 :AC Accession number
LINE 3 :DE Describe the sequence any way you want
LINE 4 :SQ Length BP
LINE 6 : ACGT...
LINE 7 ://
NBRF (protein or nucleic acid) File Format
1. The first line of each sequence entry begins with a greater than
symbol, >. This is immediately followed by the two character
sequence type specifier. Space four must contain a semi-colon.
Beginning in space five is the sequence name or identification code
for the NBRF database. The code is from four to six letters and
numbers. (See LINE 1).
!!!! >> add these to readseq
Specifier Sequence type
P1 protein, complete
F1 protein, fragment
DL DNA, linear
DC DNA, circular
RL RNA, linear
RC RNA, circular
N1 functional RNA, other than tRNA
2. The second line of each sequence entry contains two kinds of
information. First is the sequence name which is separated from
the organism or organelle name by the three character sequence
blank space, dash, blank space, " - ". There is no special
character marking the beginning of this line. (See LINE 2).
3. Either the amino acid or nucleic acid sequence begins on line three
and can begin in any space, including the first. The sequence is
free format and may be interrupted by blanks for ease of reading.
Protein sequences man contain special punctuation to indicate
various indeterminacies in the sequence. In the NBRF data files
all lines may be up to 500 characters long. However some PSC
programs currently have a limit of 130 characters per line
(including blanks), and BitNet will not accept lines of over eighty
characters. (See LINE 3, LINE 4, and LINE 5).
The last character in the sequence must be an asterisks, *.
Example NBRF file
LINE 2 :Cytochrome b - Rat mitochondrion (SGC1)
MolGen/Stanford File Format
1. The first line in a sequence file is a comment line. This line
begins with a semi-colon in the first space. This line need
not be present. If it is present it holds descriptive text.
There may be as many comment lines as desired at the first of
sequence file. (See LINE 1).
2. The second line must be present and contains an identifier or
name for the sequence in the first ten spaces. (See LINE 2).
3. The sequence begins on the third line and occupies up to eighty
spaces. Spaces may be included in the sequence for ease of
reading. The sequence continues for as many line as needed
and is terminated with a 1 or 2. 1 indicates a linear sequence
while 2 marks a circular sequence. (See LINE 3 and LINE 4).
Example MolGen/Stanford file
LINE 1 :; Describe the sequence any way you want
||||||||||| Phylip file format
Phylip 3.3 File Format (DNA sequences)
The input and output formats for PROTPARS and for RESTML are described in
their document files. In general their input formats are similar to those
described here, except that the one-letter codes for data are specific to those
programs and are described in those document files. Since the input formats
for the eight DNA sequence programs apply to all eight, they are described
here. Their input formats are standard: the data have A's, G's, C's and T's
(or U's). The first line of the input file contains the number of species and
the number of sites. As with the other programs, options information may
follow this. In the case of DNAML, DNAMLK, and DNADIST an additional line
(described in the document file for these pograms) may follow the first one.
Following this, each species starts on a new line. The first 10 characters of
that line are the species name. There then follows the base sequence of that
species, each character being one of the letters A, B, C, D, G, H, K, M, N, O,
R, S, T, U, V, W, X, Y, ?, or - (a period was also previously allowed but it is
no longer allowed, because it sometimes is used to in aligned sequences to mean
"the same as the sequence above"). Blanks will be ignored, and so will
numerical digits. This allows GENBANK and EMBL sequence entries to be read
with minimum editing.
These characters can be either upper or lower case. The algorithms
convert all input characters to upper case (which is how they are treated).
The characters constitute the IUPAC (IUB) nucleic acid code plus some slight
extensions. They enable input of nucleic acid sequences taking full account of
any ambiguities in the sequence.
The sequences can continue over multiple lines; when this is done the sequences
must be either in "interleaved" format, similar to the output of alignment
programs, or "sequential" format. These are described in the main document
file. In sequential format all of one sequence is given, possibly on multiple
lines, before the next starts. In interleaved format the first part of the
file should contain the first part of each of the sequences, then possibly a
line containing nothing but a carriage-return character, then the second part
of each sequence, and so on. Only the first parts of the sequences should be
preceded by names. Here is a hypothetical example of interleaved format:
5 42
while in sequential format the same sequences would be:
5 42
Note, of course, that a portion of a sequence like this:
is perfectly legal, assuming that the species name has gone before, and is
filled out to full length by blanks. The above digits and blanks will be
ignored, the sequence being taken as starting at the first base symbol (in this
case an A).
The present versions of the programs may sometimes have difficulties with
the blank lines between groups of lines, and if so you might want to retype
those lines, making sure that they have only a carriage-return and no blank
characters on them, or you may perhaps have to eliminate them. The symptoms of
this problem are that the programs complain that the sequences are not properly
aligned, and you can find no other cause for this complaint.
||||||||||| ASN.1 file format
ASN.1 -- see NCBI toolkit docs, source and examples (
Example asn.1 sequence file----
Bioseq-set ::= {
seq-set {
seq {
id { local id 1 } , -- id essential
descr { title "Dummy sequence data from nowhere" } , -- optional
inst { -- inst essential
repr raw ,
mol dna ,
length 156 ,
topology linear ,
} } ,
seq {
id { local id 2 } ,
descr { title "Dummy sequence 2 data from somewhere else" } ,
inst {
repr raw ,
mol dna ,
length 150 ,
topology linear ,
partial ASN.1 description from toolkit
Bioseq ::= SEQUENCE {
id SET OF Seq-id , -- equivalent identifiers
descr Seq-descr OPTIONAL , -- descriptors
inst Seq-inst , -- the sequence data
annot SET OF Seq-annot OPTIONAL }
Seq-inst ::= SEQUENCE { -- the sequence data itself
repr ENUMERATED { -- representation class
not-set (0) , -- empty
virtual (1) , -- no seq data
raw (2) , -- continuous sequence
seg (3) , -- segmented sequence
const (4) , -- constructed sequence
ref (5) , -- reference to another sequence
consen (6) , -- consensus sequence or pattern
map (7) , -- ordered map (genetic, restriction)
other (255) } ,
mol ENUMERATED { -- molecule class in living organism
not-set (0) , -- > cdna = rna
dna (1) ,
rna (2) ,
aa (3) ,
na (4) , -- just a nucleic acid
other (255) } ,
length INTEGER OPTIONAL , -- length of sequence in residues
fuzz Int-fuzz OPTIONAL , -- length uncertainty
topology ENUMERATED { -- topology of molecule
not-set (0) ,
linear (1) ,
circular (2) ,
tandem (3) , -- some part of tandem repeat
other (255) } DEFAULT linear ,
strand ENUMERATED { -- strandedness in living organism
not-set (0) ,
ss (1) , -- single strand
ds (2) , -- double strand
mixed (3) ,
other (255) } OPTIONAL , -- default ds for DNA, ss for RNA, pept
seq-data Seq-data OPTIONAL , -- the sequence
ext Seq-ext OPTIONAL , -- extensions for special types
hist Seq-hist OPTIONAL } -- sequence history