2023-04-16 07:33:28 +08:00
|
|
|
/* File: ureadseq.c
|
|
|
|
*
|
|
|
|
* Reads and writes nucleic/protein sequence in various
|
|
|
|
* formats. Data files may have multiple sequences.
|
|
|
|
*
|
|
|
|
* Copyright 1990 by d.g.gilbert
|
|
|
|
* biology dept., indiana university, bloomington, in 47405
|
|
|
|
* e-mail: gilbertd@bio.indiana.edu
|
|
|
|
*
|
|
|
|
* This program may be freely copied and used by anyone.
|
|
|
|
* Developers are encourged to incorporate parts in their
|
|
|
|
* programs, rather than devise their own private sequence
|
|
|
|
* format.
|
|
|
|
*
|
|
|
|
* This should compile and run with any ANSI C compiler.
|
|
|
|
*
|
|
|
|
*/
|
|
|
|
|
|
|
|
#include <ctype.h>
|
|
|
|
#include <stdio.h>
|
2023-04-16 13:50:30 +08:00
|
|
|
#include <stdlib.h>
|
2023-04-16 07:33:28 +08:00
|
|
|
#include <string.h>
|
|
|
|
|
|
|
|
#define UREADSEQ_G
|
|
|
|
#include "ureadseq.h"
|
|
|
|
|
|
|
|
#pragma segment ureadseq
|
|
|
|
|
|
|
|
int Strcasecmp(const char *a, const char *b) /* from Nlm_StrICmp */
|
|
|
|
{
|
|
|
|
int diff, done;
|
|
|
|
if (a == b) return 0;
|
|
|
|
done = 0;
|
|
|
|
while (!done) {
|
|
|
|
diff = to_upper(*a) - to_upper(*b);
|
|
|
|
if (diff) return diff;
|
|
|
|
if (*a == '\0')
|
|
|
|
done = 1;
|
|
|
|
else {
|
|
|
|
a++;
|
|
|
|
b++;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
return 0;
|
|
|
|
}
|
|
|
|
|
|
|
|
int Strncasecmp(const char *a, const char *b, long maxn) /* from Nlm_StrNICmp */
|
|
|
|
{
|
|
|
|
int diff, done;
|
|
|
|
if (a == b) return 0;
|
|
|
|
done = 0;
|
|
|
|
while (!done) {
|
|
|
|
diff = to_upper(*a) - to_upper(*b);
|
|
|
|
if (diff) return diff;
|
|
|
|
if (*a == '\0')
|
|
|
|
done = 1;
|
|
|
|
else {
|
|
|
|
a++;
|
|
|
|
b++;
|
|
|
|
maxn--;
|
|
|
|
if (!maxn) done = 1;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
return 0;
|
|
|
|
}
|
|
|
|
|
|
|
|
#ifndef Local
|
|
|
|
#define Local static /* local functions */
|
|
|
|
#endif
|
|
|
|
|
|
|
|
#define kStartLength 500
|
|
|
|
|
|
|
|
const char *aminos = "ABCDEFGHIKLMNPQRSTVWXYZ*";
|
|
|
|
const char *primenuc = "ACGTU";
|
|
|
|
const char *protonly = "EFIPQZ";
|
|
|
|
|
|
|
|
const char kNocountsymbols[5] = "_.-?";
|
|
|
|
const char stdsymbols[6] = "_.-*?";
|
|
|
|
const char allsymbols[32] = "_.-*?<>{}[]()!@#$%^&=+;:'/|`~\"\\";
|
|
|
|
static const char *seqsymbols = allsymbols;
|
|
|
|
|
|
|
|
const char nummask[11] = "0123456789";
|
|
|
|
const char nonummask[11] = "~!@#$%^&*(";
|
|
|
|
|
|
|
|
/*
|
|
|
|
use general form of isseqchar -- all chars + symbols.
|
|
|
|
no formats except nbrf (?) use symbols in data area as
|
|
|
|
anything other than sequence chars.
|
|
|
|
*/
|
|
|
|
|
|
|
|
/* Local variables for readSeq: */
|
|
|
|
struct ReadSeqVars {
|
|
|
|
short choice, err, nseq;
|
|
|
|
long seqlen, maxseq, seqlencount;
|
|
|
|
short topnseq;
|
|
|
|
long topseqlen;
|
|
|
|
const char *fname;
|
|
|
|
char *seq, *seqid, matchchar;
|
|
|
|
boolean allDone, done, filestart, addit;
|
|
|
|
FILE *f;
|
|
|
|
long linestart;
|
|
|
|
char s[256], *sp;
|
|
|
|
|
|
|
|
int (*isseqchar)();
|
|
|
|
/* int (*isseqchar)(int c); << sgi cc hates (int c) */
|
|
|
|
};
|
|
|
|
|
|
|
|
int isSeqChar(int c) { return (isalpha(c) || strchr(seqsymbols, c)); }
|
|
|
|
|
|
|
|
int isSeqNumChar(int c) { return (isalnum(c) || strchr(seqsymbols, c)); }
|
|
|
|
|
|
|
|
int isAnyChar(int c) { return isascii(c); /* wrap in case isascii is macro */ }
|
|
|
|
|
|
|
|
Local void readline(FILE *f, char *s, long *linestart)
|
|
|
|
{
|
|
|
|
char *cp;
|
|
|
|
|
|
|
|
*linestart = ftell(f);
|
|
|
|
if (NULL == fgets(s, 256, f))
|
|
|
|
*s = 0;
|
|
|
|
else {
|
|
|
|
cp = strchr(s, '\n');
|
|
|
|
if (cp != NULL) *cp = 0;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
2023-04-16 13:50:30 +08:00
|
|
|
Local void cgetline(struct ReadSeqVars *V)
|
2023-04-16 07:33:28 +08:00
|
|
|
{
|
|
|
|
readline(V->f, V->s, &V->linestart);
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void ungetline(struct ReadSeqVars *V) { fseek(V->f, V->linestart, 0); }
|
|
|
|
|
|
|
|
Local void addseq(char *s, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
char *ptr;
|
|
|
|
|
|
|
|
if (V->addit)
|
|
|
|
while (*s != 0) {
|
|
|
|
if ((V->isseqchar)(*s)) {
|
|
|
|
if (V->seqlen >= V->maxseq) {
|
|
|
|
V->maxseq += kStartLength;
|
|
|
|
ptr = (char *)realloc(V->seq,
|
|
|
|
V->maxseq + 1);
|
|
|
|
if (ptr == NULL) {
|
|
|
|
V->err = eMemFull;
|
|
|
|
return;
|
|
|
|
}
|
|
|
|
else
|
|
|
|
V->seq = ptr;
|
|
|
|
}
|
|
|
|
V->seq[(V->seqlen)++] = *s;
|
|
|
|
}
|
|
|
|
s++;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void countseq(char *s, struct ReadSeqVars *V)
|
|
|
|
/* this must count all valid seq chars, for some formats (paup-sequential) even
|
|
|
|
if we are skipping seq... */
|
|
|
|
{
|
|
|
|
while (*s != 0) {
|
|
|
|
if ((V->isseqchar)(*s)) {
|
|
|
|
(V->seqlencount)++;
|
|
|
|
}
|
|
|
|
s++;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void addinfo(char *s, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
char s2[256], *si;
|
|
|
|
boolean saveadd;
|
|
|
|
|
|
|
|
si = s2;
|
|
|
|
while (*s == ' ') s++;
|
|
|
|
sprintf(si, " %d) %s\n", V->nseq, s);
|
|
|
|
|
|
|
|
saveadd = V->addit;
|
|
|
|
V->addit = true;
|
|
|
|
V->isseqchar = isAnyChar;
|
|
|
|
addseq(si, V);
|
|
|
|
V->addit = saveadd;
|
|
|
|
V->isseqchar = isSeqChar;
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readLoop(short margin, boolean addfirst,
|
|
|
|
boolean (*endTest)(boolean *addend, boolean *ungetend,
|
|
|
|
struct ReadSeqVars *V),
|
|
|
|
struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
boolean addend = false;
|
|
|
|
boolean ungetend = false;
|
|
|
|
|
|
|
|
V->nseq++;
|
|
|
|
if (V->choice == kListSequences)
|
|
|
|
V->addit = false;
|
|
|
|
else
|
|
|
|
V->addit = (V->nseq == V->choice);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
|
|
|
|
if (addfirst) addseq(V->s, V);
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
V->done = feof(V->f);
|
|
|
|
V->done |= (*endTest)(&addend, &ungetend, V);
|
|
|
|
if (V->addit && (addend || !V->done) &&
|
|
|
|
(strlen(V->s) > margin)) {
|
|
|
|
addseq((V->s) + margin, V);
|
|
|
|
}
|
|
|
|
} while (!V->done);
|
|
|
|
|
|
|
|
if (V->choice == kListSequences)
|
|
|
|
addinfo(V->seqid, V);
|
|
|
|
else {
|
|
|
|
V->allDone = (V->nseq >= V->choice);
|
|
|
|
if (V->allDone && ungetend) ungetline(V);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endIG(boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = true; /* 1 or 2 occur in line w/ bases */
|
|
|
|
*ungetend = false;
|
|
|
|
return ((strchr(V->s, '1') != NULL) || (strchr(V->s, '2') != NULL));
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readIG(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
/* 18Aug92: new IG format -- ^L between sequences in place of ";" */
|
|
|
|
char *si;
|
|
|
|
|
|
|
|
while (!V->allDone) {
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
for (si = V->s; *si != 0 && *si < ' '; si++)
|
|
|
|
*si = ' '; /* drop controls */
|
|
|
|
if (*si == 0) *V->s = 0; /* chop line to empty */
|
|
|
|
} while (!(feof(V->f) || ((*V->s != 0) && (*V->s != ';'))));
|
|
|
|
if (feof(V->f))
|
|
|
|
V->allDone = true;
|
|
|
|
else {
|
|
|
|
strcpy(V->seqid, V->s);
|
|
|
|
readLoop(0, false, endIG, V);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endStrider(boolean *addend, boolean *ungetend,
|
|
|
|
struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = false;
|
|
|
|
return (strstr(V->s, "//") != NULL);
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readStrider(struct ReadSeqVars *V)
|
|
|
|
{ /* ? only 1 seq/file ? */
|
|
|
|
|
|
|
|
while (!V->allDone) {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
if (strstr(V->s, "; DNA sequence ") == V->s)
|
|
|
|
strcpy(V->seqid, (V->s) + 16);
|
|
|
|
else
|
|
|
|
strcpy(V->seqid, (V->s) + 1);
|
|
|
|
while ((!feof(V->f)) && (*V->s == ';')) {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f))
|
|
|
|
V->allDone = true;
|
|
|
|
else
|
|
|
|
readLoop(0, true, endStrider, V);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endPIR(boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = (strstr(V->s, "ENTRY") == V->s);
|
|
|
|
return ((strstr(V->s, "///") != NULL) || *ungetend);
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readPIR(struct ReadSeqVars *V)
|
|
|
|
{ /*PIR -- many seqs/file */
|
|
|
|
|
|
|
|
while (!V->allDone) {
|
|
|
|
while (!(feof(V->f) || strstr(V->s, "ENTRY") ||
|
|
|
|
strstr(V->s, "SEQUENCE")))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
strcpy(V->seqid, (V->s) + 16);
|
|
|
|
while (!(feof(V->f) || strstr(V->s, "SEQUENCE") == V->s))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
readLoop(0, false, endPIR, V);
|
|
|
|
|
|
|
|
if (!V->allDone) {
|
|
|
|
while (!(
|
|
|
|
feof(V->f) ||
|
|
|
|
((*V->s != 0) && (strstr(V->s, "ENTRY") == V->s))))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endGB(boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = (strstr(V->s, "LOCUS") == V->s);
|
|
|
|
return ((strstr(V->s, "//") != NULL) || *ungetend);
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readGenBank(struct ReadSeqVars *V)
|
|
|
|
{ /*GenBank -- many seqs/file */
|
|
|
|
|
|
|
|
while (!V->allDone) {
|
|
|
|
strcpy(V->seqid, (V->s) + 12);
|
|
|
|
while (!(feof(V->f) || strstr(V->s, "ORIGIN") == V->s))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
readLoop(0, false, endGB, V);
|
|
|
|
|
|
|
|
if (!V->allDone) {
|
|
|
|
while (!(
|
|
|
|
feof(V->f) ||
|
|
|
|
((*V->s != 0) && (strstr(V->s, "LOCUS") == V->s))))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endNBRF(boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
char *a;
|
|
|
|
|
|
|
|
if ((a = strchr(V->s, '*')) != NULL) { /* end of 1st seq */
|
|
|
|
/* "*" can be valid base symbol, drop it here */
|
|
|
|
*a = 0;
|
|
|
|
*addend = true;
|
|
|
|
*ungetend = false;
|
|
|
|
return (true);
|
|
|
|
}
|
|
|
|
else if (*V->s == '>') { /* start of next seq */
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = true;
|
|
|
|
return (true);
|
|
|
|
}
|
|
|
|
else
|
|
|
|
return (false);
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readNBRF(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
while (!V->allDone) {
|
|
|
|
strcpy(V->seqid, (V->s) + 4);
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V); /*skip title-junk line*/
|
2023-04-16 07:33:28 +08:00
|
|
|
readLoop(0, false, endNBRF, V);
|
|
|
|
if (!V->allDone) {
|
|
|
|
while (!(feof(V->f) || (*V->s != 0 && *V->s == '>')))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endPearson(boolean *addend, boolean *ungetend,
|
|
|
|
struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = true;
|
|
|
|
return (*V->s == '>');
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readPearson(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
while (!V->allDone) {
|
|
|
|
strcpy(V->seqid, (V->s) + 1);
|
|
|
|
readLoop(0, false, endPearson, V);
|
|
|
|
if (!V->allDone) {
|
|
|
|
while (
|
|
|
|
!(feof(V->f) || ((*V->s != 0) && (*V->s == '>'))))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endEMBL(boolean *addend, boolean *ungetend, struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = (strstr(V->s, "ID ") == V->s);
|
|
|
|
return ((strstr(V->s, "//") != NULL) || *ungetend);
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readEMBL(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
while (!V->allDone) {
|
|
|
|
strcpy(V->seqid, (V->s) + 5);
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
} while (!(feof(V->f) | (strstr(V->s, "SQ ") == V->s)));
|
|
|
|
|
|
|
|
readLoop(0, false, endEMBL, V);
|
|
|
|
if (!V->allDone) {
|
|
|
|
while (
|
|
|
|
!(feof(V->f) | ((*V->s != '\0') &
|
|
|
|
(strstr(V->s, "ID ") == V->s))))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endZuker(boolean *addend, boolean *ungetend,
|
|
|
|
struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = true;
|
|
|
|
return (*V->s == '(');
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readZuker(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
/*! 1st string is Zuker's Fortran format */
|
|
|
|
|
|
|
|
while (!V->allDone) {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V); /*s == "seqLen seqid string..."*/
|
2023-04-16 07:33:28 +08:00
|
|
|
strcpy(V->seqid, (V->s) + 6);
|
|
|
|
readLoop(0, false, endZuker, V);
|
|
|
|
if (!V->allDone) {
|
|
|
|
while (
|
|
|
|
!(feof(V->f) | ((*V->s != '\0') & (*V->s == '('))))
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
}
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local boolean endFitch(boolean *addend, boolean *ungetend,
|
|
|
|
struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
/* this is a somewhat shaky end,
|
|
|
|
1st char of line is non-blank for seq. title
|
|
|
|
*/
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = true;
|
|
|
|
return (*V->s != ' ');
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readFitch(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
boolean first;
|
|
|
|
|
|
|
|
first = true;
|
|
|
|
while (!V->allDone) {
|
|
|
|
if (!first) strcpy(V->seqid, V->s);
|
|
|
|
readLoop(0, first, endFitch, V);
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
first = false;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readPlain(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
V->nseq++;
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
addseq(V->seqid, V); /*from above..*/
|
|
|
|
if (V->fname != NULL)
|
|
|
|
sprintf(V->seqid, "%s [Unknown form]", V->fname);
|
|
|
|
else
|
|
|
|
sprintf(V->seqid, " [Unknown form]");
|
|
|
|
do {
|
|
|
|
addseq(V->s, V);
|
|
|
|
V->done = feof(V->f);
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
} while (!V->done);
|
|
|
|
if (V->choice == kListSequences) addinfo(V->seqid, V);
|
|
|
|
V->allDone = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readUWGCG(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
/*
|
|
|
|
10nov91: Reading GCG files casued duplication of last line when
|
|
|
|
EOF followed that line !!!
|
2023-04-16 13:50:30 +08:00
|
|
|
fix: cgetline now sets *V->s = 0
|
2023-04-16 07:33:28 +08:00
|
|
|
*/
|
|
|
|
char *si;
|
|
|
|
|
|
|
|
V->nseq++;
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
strcpy(V->seqid, V->s);
|
|
|
|
/*writeseq: " %s Length: %d (today) Check: %d ..\n" */
|
|
|
|
/*drop above or ".." from id*/
|
|
|
|
if (si = strstr(V->seqid, " Length: "))
|
|
|
|
*si = 0;
|
|
|
|
else if (si = strstr(V->seqid, ".."))
|
|
|
|
*si = 0;
|
|
|
|
do {
|
|
|
|
V->done = feof(V->f);
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
if (!V->done) addseq((V->s), V);
|
|
|
|
} while (!V->done);
|
|
|
|
if (V->choice == kListSequences) addinfo(V->seqid, V);
|
|
|
|
V->allDone = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readOlsen(struct ReadSeqVars *V)
|
|
|
|
{ /* G. Olsen /print output from multiple sequence editor */
|
|
|
|
|
|
|
|
char *si, *sj, *sk, *sm, sid[40], snum[20];
|
|
|
|
boolean indata = false;
|
|
|
|
int snumlen;
|
|
|
|
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
rewind(V->f);
|
|
|
|
V->nseq = 0;
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
V->done = feof(V->f);
|
|
|
|
|
|
|
|
if (V->done && !(*V->s))
|
|
|
|
break;
|
|
|
|
else if (indata) {
|
|
|
|
if ((si = strstr(V->s, sid))
|
|
|
|
/* && (strstr(V->s, snum) == si - snumlen - 1) ) {
|
|
|
|
*/
|
|
|
|
&& (sm = strstr(V->s, snum)) &&
|
|
|
|
(sm < si - snumlen)) {
|
|
|
|
/* Spaces are valid alignment data !! */
|
|
|
|
/* 17Oct91: Error, the left margin is 21 not 22!
|
|
|
|
*/
|
|
|
|
/* dropped some nucs up to now -- my example
|
|
|
|
* file was right shifted ! */
|
|
|
|
/* variable right id margin, drop id-2 spaces at
|
|
|
|
* end */
|
|
|
|
/*
|
|
|
|
VMS CC COMPILER (VAXC031) mess up:
|
|
|
|
-- Index of 21 is chopping 1st nuc on VMS
|
|
|
|
systems Only! Byte-for-byte same ame
|
|
|
|
rnasep.olsen sequence file !
|
|
|
|
*/
|
|
|
|
|
|
|
|
/* si = (V->s)+21; < was this before VMS CC
|
|
|
|
* wasted my time */
|
|
|
|
si += 10; /* use strstr index plus offset to
|
|
|
|
outfox VMS CC bug */
|
|
|
|
|
|
|
|
if (sk = strstr(si, sid)) *(sk - 2) = 0;
|
|
|
|
for (sk = si; *sk != 0; sk++) {
|
|
|
|
if (*sk == ' ') *sk = '.';
|
|
|
|
/* 18aug92: !! some olsen masks are
|
|
|
|
* NUMBERS !! which addseq eats */
|
|
|
|
else if (isdigit(*sk))
|
|
|
|
*sk = nonummask[*sk - '0'];
|
|
|
|
}
|
|
|
|
|
|
|
|
addseq(si, V);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (sk = strstr(V->s, "): ")) { /* seq info header line */
|
|
|
|
/* 18aug92: correct for diff seqs w/ same name -- use
|
|
|
|
* number, e.g. */
|
|
|
|
/* 3 (Agr.tume): agrobacterium.prna 18-JUN-1987
|
|
|
|
* 16:12 */
|
|
|
|
/* 328 (Agr.tume): agrobacterium.prna XYZ 19-DEC-1992
|
|
|
|
*/
|
|
|
|
(V->nseq)++;
|
|
|
|
si = 1 + strchr(V->s, '(');
|
|
|
|
*sk = ' ';
|
|
|
|
if (V->choice == kListSequences)
|
|
|
|
addinfo(si, V);
|
|
|
|
else if (V->nseq == V->choice) {
|
|
|
|
strcpy(V->seqid, si);
|
|
|
|
sj = strchr(V->seqid, ':');
|
|
|
|
while (*(--sj) == ' ')
|
|
|
|
;
|
|
|
|
while (--sj != V->seqid) {
|
|
|
|
if (*sj == ' ') *sj = '_';
|
|
|
|
}
|
|
|
|
|
|
|
|
*sk = 0;
|
|
|
|
while (*(--sk) == ' ') *sk = 0;
|
|
|
|
strcpy(sid, si);
|
|
|
|
|
|
|
|
si = V->s;
|
|
|
|
while ((*si <= ' ') && (*si != 0)) si++;
|
|
|
|
snumlen = 0;
|
|
|
|
while (si[snumlen] > ' ' && snumlen < 20) {
|
|
|
|
snum[snumlen] = si[snumlen];
|
|
|
|
snumlen++;
|
|
|
|
}
|
|
|
|
snum[snumlen] = 0;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (strstr(V->s, "identity: Data:")) {
|
|
|
|
indata = true;
|
|
|
|
if (V->choice == kListSequences) V->done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
} while (!V->done);
|
|
|
|
|
|
|
|
V->allDone = true;
|
|
|
|
} /*readOlsen*/
|
|
|
|
|
|
|
|
Local void readMSF(struct ReadSeqVars *V)
|
|
|
|
{ /* gcg's MSF, mult. sequence format, interleaved ! */
|
|
|
|
|
|
|
|
char *si, *sj, sid[128];
|
|
|
|
boolean indata = false;
|
|
|
|
int atseq = 0, iline = 0;
|
|
|
|
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
rewind(V->f);
|
|
|
|
V->nseq = 0;
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
V->done = feof(V->f);
|
|
|
|
|
|
|
|
if (V->done && !(*V->s))
|
|
|
|
break;
|
|
|
|
else if (indata) {
|
|
|
|
/*somename ...gpvedai .......t.. aaigr..vad tvgtgptnse
|
|
|
|
* aipaltaaet */
|
|
|
|
/* E gvenae.kgv tentna.tad fvaqpvylpe .nqt......
|
|
|
|
* kv.affynrs */
|
|
|
|
|
|
|
|
si = V->s;
|
|
|
|
skipwhitespace(si);
|
|
|
|
/* for (sj= si; isalnum(*sj); sj++) ; bug -- cdelwiche
|
|
|
|
* uses "-", "_" and others in names*/
|
|
|
|
for (sj = si; *sj > ' '; sj++)
|
|
|
|
;
|
|
|
|
*sj = 0;
|
|
|
|
if (*si) {
|
|
|
|
if ((0 == strcmp(si, sid))) {
|
|
|
|
addseq(sj + 1, V);
|
|
|
|
}
|
|
|
|
iline++;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (NULL !=
|
|
|
|
(si = strstr(V->s,
|
|
|
|
"Name: "))) { /* seq info header line */
|
|
|
|
/* Name: somename Len: 100 Check: 7009
|
|
|
|
* Weight: 1.00 */
|
|
|
|
|
|
|
|
(V->nseq)++;
|
|
|
|
si += 6;
|
|
|
|
if (V->choice == kListSequences)
|
|
|
|
addinfo(si, V);
|
|
|
|
else if (V->nseq == V->choice) {
|
|
|
|
strcpy(V->seqid, si);
|
|
|
|
si = V->seqid;
|
|
|
|
skipwhitespace(si);
|
|
|
|
/* for (sj= si; isalnum(*sj); sj++) ; -- bug */
|
|
|
|
for (sj = si; *sj > ' '; sj++)
|
|
|
|
;
|
|
|
|
*sj = 0;
|
|
|
|
strcpy(sid, si);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (strstr(V->s, "//") /*== V->s*/) {
|
|
|
|
indata = true;
|
|
|
|
iline = 0;
|
|
|
|
if (V->choice == kListSequences) V->done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
} while (!V->done);
|
|
|
|
|
|
|
|
V->allDone = true;
|
|
|
|
} /*readMSF*/
|
|
|
|
|
|
|
|
Local void readPAUPinterleaved(struct ReadSeqVars *V)
|
|
|
|
{ /* PAUP mult. sequence format, interleaved or sequential! */
|
|
|
|
|
|
|
|
char *si, *sj, *send, sid[40], sid1[40], saveseq[255];
|
|
|
|
boolean first = true, indata = false, domatch;
|
|
|
|
int atseq = 0, iline = 0, ifmc, saveseqlen = 0;
|
|
|
|
|
|
|
|
#define fixmatchchar(s) \
|
|
|
|
{ \
|
|
|
|
for (ifmc = 0; ifmc < saveseqlen; ifmc++) \
|
|
|
|
if (s[ifmc] == V->matchchar) s[ifmc] = saveseq[ifmc]; \
|
|
|
|
}
|
|
|
|
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
V->seqlencount = 0;
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
/* rewind(V->f); V->nseq= 0; << do in caller !*/
|
|
|
|
indata = true; /* call here after we find "matrix" */
|
|
|
|
domatch = (V->matchchar > 0);
|
|
|
|
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
V->done = feof(V->f);
|
|
|
|
|
|
|
|
if (V->done && !(*V->s))
|
|
|
|
break;
|
|
|
|
else if (indata) {
|
|
|
|
/* [ 1 1 1
|
|
|
|
* ]*/
|
|
|
|
/* human aagcttcaccggcgcagtca ttctcataatcgcccacggR
|
|
|
|
* cttacatcct*/
|
|
|
|
/* chimp ................a.t. .c.................a
|
|
|
|
* ..........*/
|
|
|
|
/* !! need to correct for V->matchchar */
|
|
|
|
si = V->s;
|
|
|
|
skipwhitespace(si);
|
|
|
|
if (strchr(si, ';')) indata = false;
|
|
|
|
|
|
|
|
if (isalnum(*si)) {
|
|
|
|
/* valid data line starts w/ a left-justified
|
|
|
|
* seq name in columns [0..8] */
|
|
|
|
if (first) {
|
|
|
|
(V->nseq)++;
|
|
|
|
if (V->nseq >= V->topnseq)
|
|
|
|
first = false;
|
|
|
|
for (sj = si; isalnum(*sj); sj++)
|
|
|
|
;
|
|
|
|
send = sj;
|
|
|
|
skipwhitespace(sj);
|
|
|
|
if (V->choice == kListSequences) {
|
|
|
|
*send = 0;
|
|
|
|
addinfo(si, V);
|
|
|
|
}
|
|
|
|
else if (V->nseq == V->choice) {
|
|
|
|
if (domatch) {
|
|
|
|
if (V->nseq == 1) {
|
|
|
|
strcpy(saveseq,
|
|
|
|
sj);
|
|
|
|
saveseqlen =
|
|
|
|
strlen(
|
|
|
|
saveseq);
|
|
|
|
}
|
|
|
|
else
|
|
|
|
fixmatchchar(
|
|
|
|
sj);
|
|
|
|
}
|
|
|
|
addseq(sj, V);
|
|
|
|
*send = 0;
|
|
|
|
strcpy(V->seqid, si);
|
|
|
|
strcpy(sid, si);
|
|
|
|
if (V->nseq == 1)
|
|
|
|
strcpy(sid1, sid);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if ((strstr(si, sid) == si)) {
|
|
|
|
while (isalnum(*si)) si++;
|
|
|
|
skipwhitespace(si);
|
|
|
|
if (domatch) {
|
|
|
|
if (V->nseq == 1) {
|
|
|
|
strcpy(saveseq, si);
|
|
|
|
saveseqlen =
|
|
|
|
strlen(saveseq);
|
|
|
|
}
|
|
|
|
else
|
|
|
|
fixmatchchar(si);
|
|
|
|
}
|
|
|
|
addseq(si, V);
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (domatch && (strstr(si, sid1) == si)) {
|
|
|
|
strcpy(saveseq, si);
|
|
|
|
saveseqlen = strlen(saveseq);
|
|
|
|
}
|
|
|
|
|
|
|
|
iline++;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (strstr(V->s, "matrix")) {
|
|
|
|
indata = true;
|
|
|
|
iline = 0;
|
|
|
|
if (V->choice == kListSequences) V->done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
} while (!V->done);
|
|
|
|
|
|
|
|
V->allDone = true;
|
|
|
|
} /*readPAUPinterleaved*/
|
|
|
|
|
|
|
|
Local void readPAUPsequential(struct ReadSeqVars *V)
|
|
|
|
{ /* PAUP mult. sequence format, interleaved or sequential! */
|
|
|
|
char *si, *sj;
|
|
|
|
boolean atname = true, indata = false;
|
|
|
|
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
V->seqlencount = 0;
|
|
|
|
/* rewind(V->f); V->nseq= 0; << do in caller !*/
|
|
|
|
indata = true; /* call here after we find "matrix" */
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
V->done = feof(V->f);
|
|
|
|
|
|
|
|
if (V->done && !(*V->s))
|
|
|
|
break;
|
|
|
|
else if (indata) {
|
|
|
|
/* [ 1 1 1
|
|
|
|
* ]*/
|
|
|
|
/* human aagcttcaccggcgcagtca ttctcataatcgcccacggR
|
|
|
|
* cttacatcct*/
|
|
|
|
/* aagcttcaccggcgcagtca ttctcataatcgcccacggR
|
|
|
|
* cttacatcct*/
|
|
|
|
/* chimp ................a.t. .c.................a
|
|
|
|
* ..........*/
|
|
|
|
/* ................a.t. .c.................a
|
|
|
|
* ..........*/
|
|
|
|
|
|
|
|
si = V->s;
|
|
|
|
skipwhitespace(si);
|
|
|
|
if (strchr(si, ';')) indata = false;
|
|
|
|
if (isalnum(*si)) {
|
|
|
|
/* valid data line starts w/ a left-justified
|
|
|
|
* seq name in columns [0..8] */
|
|
|
|
if (atname) {
|
|
|
|
(V->nseq)++;
|
|
|
|
V->seqlencount = 0;
|
|
|
|
atname = false;
|
|
|
|
sj = si + 1;
|
|
|
|
while (isalnum(*sj)) sj++;
|
|
|
|
if (V->choice == kListSequences) {
|
|
|
|
/* !! we must count bases to
|
|
|
|
* know when topseqlen is
|
|
|
|
* reached ! */
|
|
|
|
countseq(sj, V);
|
|
|
|
if (V->seqlencount >=
|
|
|
|
V->topseqlen)
|
|
|
|
atname = true;
|
|
|
|
*sj = 0;
|
|
|
|
addinfo(si, V);
|
|
|
|
}
|
|
|
|
else if (V->nseq == V->choice) {
|
|
|
|
addseq(sj, V);
|
|
|
|
V->seqlencount = V->seqlen;
|
|
|
|
if (V->seqlencount >=
|
|
|
|
V->topseqlen)
|
|
|
|
atname = true;
|
|
|
|
*sj = 0;
|
|
|
|
strcpy(V->seqid, si);
|
|
|
|
}
|
|
|
|
else {
|
|
|
|
countseq(sj, V);
|
|
|
|
if (V->seqlencount >=
|
|
|
|
V->topseqlen)
|
|
|
|
atname = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (V->nseq == V->choice) {
|
|
|
|
addseq(V->s, V);
|
|
|
|
V->seqlencount = V->seqlen;
|
|
|
|
if (V->seqlencount >= V->topseqlen)
|
|
|
|
atname = true;
|
|
|
|
}
|
|
|
|
else {
|
|
|
|
countseq(V->s, V);
|
|
|
|
if (V->seqlencount >= V->topseqlen)
|
|
|
|
atname = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (strstr(V->s, "matrix")) {
|
|
|
|
indata = true;
|
|
|
|
atname = true;
|
|
|
|
if (V->choice == kListSequences) V->done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
} while (!V->done);
|
|
|
|
|
|
|
|
V->allDone = true;
|
|
|
|
} /*readPAUPsequential*/
|
|
|
|
|
|
|
|
Local void readPhylipInterleaved(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
char *si, *sj;
|
|
|
|
boolean first = true;
|
|
|
|
int iline = 0;
|
|
|
|
|
|
|
|
V->addit = (V->choice > 0);
|
|
|
|
if (V->addit) V->seqlen = 0;
|
|
|
|
V->seqlencount = 0;
|
|
|
|
/* sscanf( V->s, "%d%d", &V->topnseq, &V->topseqlen); << topnseq == 0
|
|
|
|
* !!! bad scan !! */
|
|
|
|
si = V->s;
|
|
|
|
skipwhitespace(si);
|
|
|
|
V->topnseq = atoi(si);
|
|
|
|
while (isdigit(*si)) si++;
|
|
|
|
skipwhitespace(si);
|
|
|
|
V->topseqlen = atol(si);
|
|
|
|
/* fprintf(stderr,"Phylip-ileaf: topnseq=%d topseqlen=%d\n",V->topnseq,
|
|
|
|
* V->topseqlen); */
|
|
|
|
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
V->done = feof(V->f);
|
|
|
|
|
|
|
|
if (V->done && !(*V->s)) break;
|
|
|
|
si = V->s;
|
|
|
|
skipwhitespace(si);
|
|
|
|
if (*si != 0) {
|
|
|
|
if (first) { /* collect seq names + seq, as
|
|
|
|
fprintf(outf,"%-10s ",seqname); */
|
|
|
|
(V->nseq)++;
|
|
|
|
if (V->nseq >= V->topnseq) first = false;
|
|
|
|
sj = V->s + 10; /* past name, start of data */
|
|
|
|
if (V->choice == kListSequences) {
|
|
|
|
*sj = 0;
|
|
|
|
addinfo(si, V);
|
|
|
|
}
|
|
|
|
else if (V->nseq == V->choice) {
|
|
|
|
addseq(sj, V);
|
|
|
|
*sj = 0;
|
|
|
|
strcpy(V->seqid, si);
|
|
|
|
}
|
|
|
|
}
|
|
|
|
else if (iline % V->nseq == V->choice - 1) {
|
|
|
|
addseq(si, V);
|
|
|
|
}
|
|
|
|
iline++;
|
|
|
|
}
|
|
|
|
} while (!V->done);
|
|
|
|
|
|
|
|
V->allDone = true;
|
|
|
|
} /*readPhylipInterleaved*/
|
|
|
|
|
|
|
|
Local boolean endPhylipSequential(boolean *addend, boolean *ungetend,
|
|
|
|
struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
*addend = false;
|
|
|
|
*ungetend = false;
|
|
|
|
countseq(V->s, V);
|
|
|
|
return V->seqlencount >= V->topseqlen;
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readPhylipSequential(struct ReadSeqVars *V)
|
|
|
|
{
|
|
|
|
short i;
|
|
|
|
char *si;
|
|
|
|
/* sscanf( V->s, "%d%d", &V->topnseq, &V->topseqlen); < ? bad sscan ? */
|
|
|
|
si = V->s;
|
|
|
|
skipwhitespace(si);
|
|
|
|
V->topnseq = atoi(si);
|
|
|
|
while (isdigit(*si)) si++;
|
|
|
|
skipwhitespace(si);
|
|
|
|
V->topseqlen = atol(si);
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
while (!V->allDone) {
|
|
|
|
V->seqlencount = 0;
|
|
|
|
strncpy(V->seqid, (V->s), 10);
|
|
|
|
V->seqid[10] = 0;
|
|
|
|
for (i = 0; i < 10 && V->s[i]; i++) V->s[i] = ' ';
|
|
|
|
readLoop(0, true, endPhylipSequential, V);
|
|
|
|
if (feof(V->f)) V->allDone = true;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
Local void readSeqMain(struct ReadSeqVars *V, const long skiplines_,
|
|
|
|
const short format_)
|
|
|
|
{
|
|
|
|
#define tolowerstr(s) \
|
|
|
|
{ \
|
|
|
|
long Itlwr, Ntlwr = strlen(s); \
|
|
|
|
for (Itlwr = 0; Itlwr < Ntlwr; Itlwr++) \
|
|
|
|
s[Itlwr] = to_lower(s[Itlwr]); \
|
|
|
|
}
|
|
|
|
|
|
|
|
boolean gotuw;
|
|
|
|
long l;
|
|
|
|
|
|
|
|
V->linestart = 0;
|
|
|
|
V->matchchar = 0;
|
|
|
|
if (V->f == NULL)
|
|
|
|
V->err = eFileNotFound;
|
|
|
|
else {
|
2023-04-16 13:50:30 +08:00
|
|
|
for (l = skiplines_; l > 0; l--) cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
|
|
|
|
do {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
for (l = strlen(V->s); (l > 0) && (V->s[l] == ' '); l--)
|
|
|
|
;
|
|
|
|
} while ((l == 0) && !feof(V->f));
|
|
|
|
|
|
|
|
if (feof(V->f))
|
|
|
|
V->err = eNoData;
|
|
|
|
|
|
|
|
else
|
|
|
|
switch (format_) {
|
|
|
|
case kPlain:
|
|
|
|
readPlain(V);
|
|
|
|
break;
|
|
|
|
case kIG:
|
|
|
|
readIG(V);
|
|
|
|
break;
|
|
|
|
case kStrider:
|
|
|
|
readStrider(V);
|
|
|
|
break;
|
|
|
|
case kGenBank:
|
|
|
|
readGenBank(V);
|
|
|
|
break;
|
|
|
|
case kPIR:
|
|
|
|
readPIR(V);
|
|
|
|
break;
|
|
|
|
case kNBRF:
|
|
|
|
readNBRF(V);
|
|
|
|
break;
|
|
|
|
case kPearson:
|
|
|
|
readPearson(V);
|
|
|
|
break;
|
|
|
|
case kEMBL:
|
|
|
|
readEMBL(V);
|
|
|
|
break;
|
|
|
|
case kZuker:
|
|
|
|
readZuker(V);
|
|
|
|
break;
|
|
|
|
case kOlsen:
|
|
|
|
readOlsen(V);
|
|
|
|
break;
|
|
|
|
case kMSF:
|
|
|
|
readMSF(V);
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kPAUP: {
|
|
|
|
boolean done = false;
|
|
|
|
boolean interleaved = false;
|
|
|
|
char *cp;
|
|
|
|
/* rewind(V->f); V->nseq= 0; ?? assume
|
|
|
|
* it is at top ?? skiplines ... */
|
|
|
|
while (!done) {
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
tolowerstr(V->s);
|
|
|
|
if (strstr(V->s, "matrix"))
|
|
|
|
done = true;
|
|
|
|
if (strstr(V->s, "interleav"))
|
|
|
|
interleaved = true;
|
|
|
|
if (NULL !=
|
|
|
|
(cp =
|
|
|
|
strstr(V->s, "ntax=")))
|
|
|
|
V->topnseq =
|
|
|
|
atoi(cp + 5);
|
|
|
|
if (NULL !=
|
|
|
|
(cp = strstr(V->s,
|
|
|
|
"nchar=")))
|
|
|
|
V->topseqlen =
|
|
|
|
atoi(cp + 6);
|
|
|
|
if (NULL !=
|
|
|
|
(cp = strstr(
|
|
|
|
V->s, "matchchar="))) {
|
|
|
|
cp += 10;
|
|
|
|
if (*cp == '\'')
|
|
|
|
cp++;
|
|
|
|
else if (*cp == '"')
|
|
|
|
cp++;
|
|
|
|
V->matchchar = *cp;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
if (interleaved)
|
|
|
|
readPAUPinterleaved(V);
|
|
|
|
else
|
|
|
|
readPAUPsequential(V);
|
|
|
|
} break;
|
|
|
|
|
|
|
|
/* kPhylip: ! can't determine in middle of file
|
|
|
|
* which type it is...*/
|
|
|
|
/* test for interleave or sequential and use
|
|
|
|
* Phylip4(ileave) or Phylip2 */
|
|
|
|
case kPhylip2:
|
|
|
|
readPhylipSequential(V);
|
|
|
|
break;
|
|
|
|
case kPhylip4: /* == kPhylip3 */
|
|
|
|
readPhylipInterleaved(V);
|
|
|
|
break;
|
|
|
|
|
|
|
|
default:
|
|
|
|
V->err = eUnknownFormat;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kFitch:
|
|
|
|
strcpy(V->seqid, V->s);
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
readFitch(V);
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kGCG:
|
|
|
|
do {
|
|
|
|
gotuw = (strstr(V->s, "..") !=
|
|
|
|
NULL);
|
|
|
|
if (gotuw) readUWGCG(V);
|
2023-04-16 13:50:30 +08:00
|
|
|
cgetline(V);
|
2023-04-16 07:33:28 +08:00
|
|
|
} while (!(feof(V->f) || V->allDone));
|
|
|
|
break;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
V->filestart = false;
|
|
|
|
V->seq[V->seqlen] = 0; /* stick a string terminator on it */
|
|
|
|
}
|
|
|
|
|
|
|
|
char *readSeqFp(const short whichEntry_, /* index to sequence in file */
|
|
|
|
FILE *fp_, /* pointer to open seq file */
|
|
|
|
const long skiplines_,
|
|
|
|
const short format_, /* sequence file format */
|
|
|
|
long *seqlen_, /* return seq size */
|
|
|
|
short *nseq_, /* number of seqs in file, for listSeqs() */
|
|
|
|
short *error_, /* return error */
|
|
|
|
char *seqid_) /* return seq name/info */
|
|
|
|
{
|
|
|
|
struct ReadSeqVars V;
|
|
|
|
|
|
|
|
if (format_ < kMinFormat || format_ > kMaxFormat) {
|
|
|
|
*error_ = eUnknownFormat;
|
|
|
|
*seqlen_ = 0;
|
|
|
|
return NULL;
|
|
|
|
}
|
|
|
|
|
|
|
|
V.choice = whichEntry_;
|
|
|
|
V.fname = NULL; /* don't know */
|
|
|
|
V.seq = (char *)calloc(1, kStartLength + 1);
|
|
|
|
V.maxseq = kStartLength;
|
|
|
|
V.seqlen = 0;
|
|
|
|
V.seqid = seqid_;
|
|
|
|
|
|
|
|
V.f = fp_;
|
|
|
|
V.filestart = (ftell(fp_) == 0);
|
|
|
|
/* !! in sequential read, must remove current seq position from
|
|
|
|
* choice/whichEntry_ counter !! ... */
|
|
|
|
if (V.filestart)
|
|
|
|
V.nseq = 0;
|
|
|
|
else
|
|
|
|
V.nseq = *nseq_; /* track where we are in file...*/
|
|
|
|
|
|
|
|
*V.seqid = '\0';
|
|
|
|
V.err = 0;
|
|
|
|
V.nseq = 0;
|
|
|
|
V.isseqchar = isSeqChar;
|
|
|
|
if (V.choice == kListSequences)
|
|
|
|
; /* leave as is */
|
|
|
|
else if (V.choice <= 0)
|
|
|
|
V.choice = 1; /* default ?? */
|
|
|
|
V.addit = (V.choice > 0);
|
|
|
|
V.allDone = false;
|
|
|
|
|
|
|
|
readSeqMain(&V, skiplines_, format_);
|
|
|
|
|
|
|
|
*error_ = V.err;
|
|
|
|
*seqlen_ = V.seqlen;
|
|
|
|
*nseq_ = V.nseq;
|
|
|
|
return V.seq;
|
|
|
|
}
|
|
|
|
|
|
|
|
char *readSeq(const short whichEntry_, /* index to sequence in file */
|
|
|
|
const char *filename_, /* file name */
|
|
|
|
const long skiplines_,
|
|
|
|
const short format_, /* sequence file format */
|
|
|
|
long *seqlen_, /* return seq size */
|
|
|
|
short *nseq_, /* number of seqs in file, for listSeqs() */
|
|
|
|
short *error_, /* return error */
|
|
|
|
char *seqid_) /* return seq name/info */
|
|
|
|
{
|
|
|
|
struct ReadSeqVars V;
|
|
|
|
|
|
|
|
if (format_ < kMinFormat || format_ > kMaxFormat) {
|
|
|
|
*error_ = eUnknownFormat;
|
|
|
|
*seqlen_ = 0;
|
|
|
|
return NULL;
|
|
|
|
}
|
|
|
|
|
|
|
|
V.choice = whichEntry_;
|
|
|
|
V.fname = filename_; /* don't need to copy string, just ptr to it */
|
|
|
|
V.seq = (char *)calloc(1, kStartLength + 1);
|
|
|
|
V.maxseq = kStartLength;
|
|
|
|
V.seqlen = 0;
|
|
|
|
V.seqid = seqid_;
|
|
|
|
|
|
|
|
V.f = NULL;
|
|
|
|
*V.seqid = '\0';
|
|
|
|
V.err = 0;
|
|
|
|
V.nseq = 0;
|
|
|
|
V.isseqchar = isSeqChar;
|
|
|
|
if (V.choice == kListSequences)
|
|
|
|
; /* leave as is */
|
|
|
|
else if (V.choice <= 0)
|
|
|
|
V.choice = 1; /* default ?? */
|
|
|
|
V.addit = (V.choice > 0);
|
|
|
|
V.allDone = false;
|
|
|
|
|
|
|
|
V.f = fopen(V.fname, "r");
|
|
|
|
V.filestart = true;
|
|
|
|
|
|
|
|
readSeqMain(&V, skiplines_, format_);
|
|
|
|
|
|
|
|
if (V.f != NULL) fclose(V.f);
|
|
|
|
*error_ = V.err;
|
|
|
|
*seqlen_ = V.seqlen;
|
|
|
|
*nseq_ = V.nseq;
|
|
|
|
return V.seq;
|
|
|
|
}
|
|
|
|
|
|
|
|
char *listSeqs(const char *filename_, /* file name */
|
|
|
|
const long skiplines_,
|
|
|
|
const short format_, /* sequence file format */
|
|
|
|
short *nseq_, /* number of seqs in file, for listSeqs() */
|
|
|
|
short *error_) /* return error */
|
|
|
|
{
|
|
|
|
char seqid[256];
|
|
|
|
long seqlen;
|
|
|
|
|
|
|
|
return readSeq(kListSequences, filename_, skiplines_, format_, &seqlen,
|
|
|
|
nseq_, error_, seqid);
|
|
|
|
}
|
|
|
|
|
|
|
|
short seqFileFormat(/* return sequence format number, see ureadseq.h */
|
|
|
|
const char *filename,
|
|
|
|
long *skiplines, /* return #lines to skip any junk like mail
|
|
|
|
header */
|
|
|
|
short *error) /* return any error value or 0 */
|
|
|
|
{
|
|
|
|
FILE *fseq;
|
|
|
|
short format;
|
|
|
|
|
|
|
|
fseq = fopen(filename, "r");
|
|
|
|
format = seqFileFormatFp(fseq, skiplines, error);
|
|
|
|
if (fseq != NULL) fclose(fseq);
|
|
|
|
return format;
|
|
|
|
}
|
|
|
|
|
|
|
|
short seqFileFormatFp(
|
|
|
|
FILE *fseq,
|
|
|
|
long *skiplines, /* return #lines to skip any junk like mail header */
|
|
|
|
short *error) /* return any error value or 0 */
|
|
|
|
{
|
|
|
|
boolean foundDNA = false, foundIG = false, foundStrider = false,
|
|
|
|
foundGB = false, foundPIR = false, foundEMBL = false,
|
|
|
|
foundNBRF = false, foundPearson = false, foundFitch = false,
|
|
|
|
foundPhylip = false, foundZuker = false, gotolsen = false,
|
|
|
|
gotpaup = false, gotasn1 = false, gotuw = false, gotMSF = false,
|
|
|
|
isfitch = false, isphylip = false, done = false;
|
|
|
|
short format = kUnknown;
|
|
|
|
int nlines = 0, k, splen = 0, otherlines = 0, aminolines = 0,
|
|
|
|
dnalines = 0;
|
|
|
|
char sp[256];
|
|
|
|
long linestart = 0;
|
|
|
|
int maxlines2check = 500;
|
|
|
|
|
|
|
|
#define ReadOneLine(sp) \
|
|
|
|
{ \
|
|
|
|
done |= (feof(fseq)); \
|
|
|
|
readline(fseq, sp, &linestart); \
|
|
|
|
if (!done) { \
|
|
|
|
splen = strlen(sp); \
|
|
|
|
++nlines; \
|
|
|
|
} \
|
|
|
|
}
|
|
|
|
|
|
|
|
*skiplines = 0;
|
|
|
|
*error = 0;
|
|
|
|
if (fseq == NULL) {
|
|
|
|
*error = eFileNotFound;
|
|
|
|
return kNoformat;
|
|
|
|
}
|
|
|
|
|
|
|
|
while (!done) {
|
|
|
|
ReadOneLine(sp);
|
|
|
|
|
|
|
|
/* check for mailer head & skip past if found */
|
|
|
|
if (nlines < 4 && !done) {
|
|
|
|
if ((strstr(sp, "From ") == sp) ||
|
|
|
|
(strstr(sp, "Received:") == sp)) {
|
|
|
|
do {
|
|
|
|
/* skip all lines until find one blank
|
|
|
|
* line */
|
|
|
|
ReadOneLine(sp);
|
|
|
|
if (!done)
|
|
|
|
for (k = 0; (k < splen) &&
|
|
|
|
(sp[k] == ' ');
|
|
|
|
k++)
|
|
|
|
;
|
|
|
|
} while ((!done) && (k < splen));
|
|
|
|
*skiplines = nlines; /* !? do we want #lines or
|
|
|
|
#bytes ?? */
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
if (sp == NULL || *sp == 0)
|
|
|
|
; /* nada */
|
|
|
|
|
|
|
|
/* high probability identities: */
|
|
|
|
|
|
|
|
else if (strstr(sp, "MSF:") && strstr(sp, "Type:") &&
|
|
|
|
strstr(sp, "Check:"))
|
|
|
|
gotMSF = true;
|
|
|
|
|
|
|
|
else if ((strstr(sp, "..") != NULL) &&
|
|
|
|
(strstr(sp, "Check:") != NULL))
|
|
|
|
gotuw = true;
|
|
|
|
|
|
|
|
else if (strstr(sp, "identity: Data:") != NULL)
|
|
|
|
gotolsen = true;
|
|
|
|
|
|
|
|
else if (strstr(sp, "::=") &&
|
|
|
|
(strstr(sp, "Bioseq") || /* Bioseq or Bioseq-set */
|
|
|
|
strstr(sp, "Seq-entry") ||
|
|
|
|
strstr(
|
|
|
|
sp,
|
|
|
|
"Seq-submit"))) /* can we read submit format? */
|
|
|
|
gotasn1 = true;
|
|
|
|
|
|
|
|
else if (strstr(sp, "#NEXUS") == sp)
|
|
|
|
gotpaup = true;
|
|
|
|
|
|
|
|
/* uncertain identities: */
|
|
|
|
|
|
|
|
else if (*sp == ';') {
|
|
|
|
if (strstr(sp, "Strider") != NULL)
|
|
|
|
foundStrider = true;
|
|
|
|
else
|
|
|
|
foundIG = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (strstr(sp, "LOCUS") == sp)
|
|
|
|
foundGB = true;
|
|
|
|
else if (strstr(sp, "ORIGIN") == sp)
|
|
|
|
foundGB = true;
|
|
|
|
|
|
|
|
else if (strstr(sp, "ENTRY ") ==
|
|
|
|
sp) /* ? also (strcmp(sp,"\\\\\\")==0) */
|
|
|
|
foundPIR = true;
|
|
|
|
else if (strstr(sp, "SEQUENCE") == sp)
|
|
|
|
foundPIR = true;
|
|
|
|
|
|
|
|
else if (*sp == '>') {
|
|
|
|
if (sp[3] == ';')
|
|
|
|
foundNBRF = true;
|
|
|
|
else
|
|
|
|
foundPearson = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (strstr(sp, "ID ") == sp)
|
|
|
|
foundEMBL = true;
|
|
|
|
else if (strstr(sp, "SQ ") == sp)
|
|
|
|
foundEMBL = true;
|
|
|
|
|
|
|
|
else if (*sp == '(')
|
|
|
|
foundZuker = true;
|
|
|
|
|
|
|
|
else {
|
|
|
|
if (nlines - *skiplines == 1) {
|
|
|
|
int ispp = 0, ilen = 0;
|
|
|
|
sscanf(sp, "%d%d", &ispp, &ilen);
|
|
|
|
if (ispp > 0 && ilen > 0) isphylip = true;
|
|
|
|
}
|
|
|
|
else if (isphylip && nlines - *skiplines == 2) {
|
|
|
|
int tseq;
|
|
|
|
tseq = getseqtype(sp + 10, strlen(sp + 10));
|
|
|
|
if (isalpha(*sp) /* 1st letter in 2nd line must
|
|
|
|
be of a name */
|
|
|
|
&& (tseq != kOtherSeq)) /* sequence section
|
|
|
|
must be okay */
|
|
|
|
foundPhylip = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
for (k = 0, isfitch = true; isfitch & (k < splen);
|
|
|
|
k++) {
|
|
|
|
if (k % 4 == 0)
|
|
|
|
isfitch &= (sp[k] == ' ');
|
|
|
|
else
|
|
|
|
isfitch &= (sp[k] != ' ');
|
|
|
|
}
|
|
|
|
if (isfitch & (splen > 20)) foundFitch = true;
|
|
|
|
|
|
|
|
/* kRNA && kDNA are fairly certain...*/
|
|
|
|
switch (getseqtype(sp, splen)) {
|
|
|
|
case kOtherSeq:
|
|
|
|
otherlines++;
|
|
|
|
break;
|
|
|
|
case kAmino:
|
|
|
|
if (splen > 20) aminolines++;
|
|
|
|
break;
|
|
|
|
case kDNA:
|
|
|
|
case kRNA:
|
|
|
|
if (splen > 20) dnalines++;
|
|
|
|
break;
|
|
|
|
case kNucleic:
|
|
|
|
break; /* not much info ? */
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
/* pretty certain */
|
|
|
|
if (gotolsen) {
|
|
|
|
format = kOlsen;
|
|
|
|
done = true;
|
|
|
|
}
|
|
|
|
else if (gotMSF) {
|
|
|
|
format = kMSF;
|
|
|
|
done = true;
|
|
|
|
}
|
|
|
|
else if (gotasn1) {
|
|
|
|
/* !! we need to look further and return kASNseqentry |
|
|
|
|
* kASNseqset */
|
|
|
|
/*
|
|
|
|
seqentry key is Seq-entry ::=
|
|
|
|
seqset key is Bioseq-set ::=
|
|
|
|
?? can't read these yet w/ ncbi tools ??
|
|
|
|
Seq-submit ::=
|
|
|
|
Bioseq ::= << fails both bioseq-seq and seq-entry
|
|
|
|
parsers !
|
|
|
|
*/
|
|
|
|
if (strstr(sp, "Bioseq-set"))
|
|
|
|
format = kASNseqset;
|
|
|
|
else if (strstr(sp, "Seq-entry"))
|
|
|
|
format = kASNseqentry;
|
|
|
|
else
|
|
|
|
format = kASN1; /* other form, we can't yet
|
|
|
|
read... */
|
|
|
|
done = true;
|
|
|
|
}
|
|
|
|
else if (gotpaup) {
|
|
|
|
format = kPAUP;
|
|
|
|
done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
else if (gotuw) {
|
|
|
|
if (foundIG)
|
|
|
|
format =
|
|
|
|
kIG; /* a TOIG file from GCG for certain */
|
|
|
|
else
|
|
|
|
format = kGCG;
|
|
|
|
done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
else if ((dnalines > 1) || done || (nlines > maxlines2check)) {
|
|
|
|
/* decide on most likely format */
|
|
|
|
/* multichar idents: */
|
|
|
|
if (foundStrider)
|
|
|
|
format = kStrider;
|
|
|
|
else if (foundGB)
|
|
|
|
format = kGenBank;
|
|
|
|
else if (foundPIR)
|
|
|
|
format = kPIR;
|
|
|
|
else if (foundEMBL)
|
|
|
|
format = kEMBL;
|
|
|
|
else if (foundNBRF)
|
|
|
|
format = kNBRF;
|
|
|
|
/* single char idents: */
|
|
|
|
else if (foundIG)
|
|
|
|
format = kIG;
|
|
|
|
else if (foundPearson)
|
|
|
|
format = kPearson;
|
|
|
|
else if (foundZuker)
|
|
|
|
format = kZuker;
|
|
|
|
/* digit ident: */
|
|
|
|
else if (foundPhylip)
|
|
|
|
format = kPhylip;
|
|
|
|
/* spacing ident: */
|
|
|
|
else if (foundFitch)
|
|
|
|
format = kFitch;
|
|
|
|
/* no format chars: */
|
|
|
|
else if (otherlines > 0)
|
|
|
|
format = kUnknown;
|
|
|
|
else if (dnalines > 1)
|
|
|
|
format = kPlain;
|
|
|
|
else if (aminolines > 1)
|
|
|
|
format = kPlain;
|
|
|
|
else
|
|
|
|
format = kUnknown;
|
|
|
|
|
|
|
|
done = true;
|
|
|
|
}
|
|
|
|
|
|
|
|
/* need this for possible long header in olsen format */
|
|
|
|
else if (strstr(sp, "): ") != NULL)
|
|
|
|
maxlines2check++;
|
|
|
|
}
|
|
|
|
|
|
|
|
if (format == kPhylip) {
|
|
|
|
/* check for interleaved or sequential -- really messy */
|
|
|
|
int tname, tseq;
|
|
|
|
long i, j, nspp = 0, nlen = 0, ilen, leaf = 0, seq = 0;
|
|
|
|
char *ps;
|
|
|
|
|
|
|
|
rewind(fseq);
|
|
|
|
for (i = 0; i < *skiplines; i++) ReadOneLine(sp);
|
|
|
|
nlines = 0;
|
|
|
|
ReadOneLine(sp);
|
|
|
|
sscanf(sp, "%d%d", &nspp, &nlen);
|
|
|
|
ReadOneLine(sp); /* 1st seq line */
|
|
|
|
for (ps = sp + 10, ilen = 0; *ps != 0; ps++)
|
|
|
|
if (isprint(*ps)) ilen++;
|
|
|
|
|
|
|
|
for (i = 1; i < nspp; i++) {
|
|
|
|
ReadOneLine(sp);
|
|
|
|
|
|
|
|
tseq = getseqtype(sp + 10, strlen(sp + 10));
|
|
|
|
tname = getseqtype(sp, 10);
|
|
|
|
for (j = 0, ps = sp; isspace(*ps) && j < 10; ps++, j++)
|
|
|
|
;
|
|
|
|
for (ps = sp; *ps != 0; ps++)
|
|
|
|
if (isprint(*ps)) ilen++;
|
|
|
|
|
|
|
|
/* find probable interleaf or sequential ... */
|
|
|
|
if (j >= 9)
|
|
|
|
seq += 10; /* pretty certain not ileaf */
|
|
|
|
else {
|
|
|
|
if (tseq != tname)
|
|
|
|
leaf++;
|
|
|
|
else
|
|
|
|
seq++;
|
|
|
|
if (tname == kDNA || tname == kRNA)
|
|
|
|
seq++;
|
|
|
|
else
|
|
|
|
leaf++;
|
|
|
|
}
|
|
|
|
|
|
|
|
if (ilen <= nlen && j < 9) {
|
|
|
|
if (tname == kOtherSeq)
|
|
|
|
leaf += 10;
|
|
|
|
else if (tname == kAmino || tname == kDNA ||
|
|
|
|
tname == kRNA)
|
|
|
|
seq++;
|
|
|
|
else
|
|
|
|
leaf++;
|
|
|
|
}
|
|
|
|
else if (ilen > nlen) {
|
|
|
|
ilen = 0;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
for (nspp *= 2; i < nspp;
|
|
|
|
i++) { /* this should be only bases if interleaf */
|
|
|
|
ReadOneLine(sp);
|
|
|
|
|
|
|
|
tseq = getseqtype(sp + 10, strlen(sp + 10));
|
|
|
|
tname = getseqtype(sp, 10);
|
|
|
|
for (ps = sp; *ps != 0; ps++)
|
|
|
|
if (isprint(*ps)) ilen++;
|
|
|
|
for (j = 0, ps = sp; isspace(*ps) && j < 10; ps++, j++)
|
|
|
|
;
|
|
|
|
if (j < 9) {
|
|
|
|
if (tname == kOtherSeq) seq += 10;
|
|
|
|
if (tseq != tname)
|
|
|
|
seq++;
|
|
|
|
else
|
|
|
|
leaf++;
|
|
|
|
if (tname == kDNA || tname == kRNA)
|
|
|
|
leaf++;
|
|
|
|
else
|
|
|
|
seq++;
|
|
|
|
}
|
|
|
|
if (ilen > nlen) {
|
|
|
|
if (j > 9)
|
|
|
|
leaf += 10; /* must be a name here for
|
|
|
|
sequent */
|
|
|
|
else if (tname == kOtherSeq)
|
|
|
|
seq += 10;
|
|
|
|
ilen = 0;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
if (leaf > seq)
|
|
|
|
format = kPhylip4;
|
|
|
|
else
|
|
|
|
format = kPhylip2;
|
|
|
|
}
|
|
|
|
|
|
|
|
return (format);
|
|
|
|
#undef ReadOneLine
|
|
|
|
} /* SeqFileFormat */
|
|
|
|
|
|
|
|
unsigned long GCGchecksum(const char *seq, const long seqlen,
|
|
|
|
unsigned long *checktotal)
|
|
|
|
/* GCGchecksum */
|
|
|
|
{
|
|
|
|
register long i, check = 0, count = 0;
|
|
|
|
|
|
|
|
for (i = 0; i < seqlen; i++) {
|
|
|
|
count++;
|
|
|
|
check += count * to_upper(seq[i]);
|
|
|
|
if (count == 57) count = 0;
|
|
|
|
}
|
|
|
|
check %= 10000;
|
|
|
|
*checktotal += check;
|
|
|
|
*checktotal %= 10000;
|
|
|
|
return check;
|
|
|
|
}
|
|
|
|
|
|
|
|
/* Table of CRC-32's of all single byte values (made by makecrc.c of ZIP source)
|
|
|
|
*/
|
|
|
|
const unsigned long crctab[] = {
|
|
|
|
0x00000000L, 0x77073096L, 0xee0e612cL, 0x990951baL, 0x076dc419L,
|
|
|
|
0x706af48fL, 0xe963a535L, 0x9e6495a3L, 0x0edb8832L, 0x79dcb8a4L,
|
|
|
|
0xe0d5e91eL, 0x97d2d988L, 0x09b64c2bL, 0x7eb17cbdL, 0xe7b82d07L,
|
|
|
|
0x90bf1d91L, 0x1db71064L, 0x6ab020f2L, 0xf3b97148L, 0x84be41deL,
|
|
|
|
0x1adad47dL, 0x6ddde4ebL, 0xf4d4b551L, 0x83d385c7L, 0x136c9856L,
|
|
|
|
0x646ba8c0L, 0xfd62f97aL, 0x8a65c9ecL, 0x14015c4fL, 0x63066cd9L,
|
|
|
|
0xfa0f3d63L, 0x8d080df5L, 0x3b6e20c8L, 0x4c69105eL, 0xd56041e4L,
|
|
|
|
0xa2677172L, 0x3c03e4d1L, 0x4b04d447L, 0xd20d85fdL, 0xa50ab56bL,
|
|
|
|
0x35b5a8faL, 0x42b2986cL, 0xdbbbc9d6L, 0xacbcf940L, 0x32d86ce3L,
|
|
|
|
0x45df5c75L, 0xdcd60dcfL, 0xabd13d59L, 0x26d930acL, 0x51de003aL,
|
|
|
|
0xc8d75180L, 0xbfd06116L, 0x21b4f4b5L, 0x56b3c423L, 0xcfba9599L,
|
|
|
|
0xb8bda50fL, 0x2802b89eL, 0x5f058808L, 0xc60cd9b2L, 0xb10be924L,
|
|
|
|
0x2f6f7c87L, 0x58684c11L, 0xc1611dabL, 0xb6662d3dL, 0x76dc4190L,
|
|
|
|
0x01db7106L, 0x98d220bcL, 0xefd5102aL, 0x71b18589L, 0x06b6b51fL,
|
|
|
|
0x9fbfe4a5L, 0xe8b8d433L, 0x7807c9a2L, 0x0f00f934L, 0x9609a88eL,
|
|
|
|
0xe10e9818L, 0x7f6a0dbbL, 0x086d3d2dL, 0x91646c97L, 0xe6635c01L,
|
|
|
|
0x6b6b51f4L, 0x1c6c6162L, 0x856530d8L, 0xf262004eL, 0x6c0695edL,
|
|
|
|
0x1b01a57bL, 0x8208f4c1L, 0xf50fc457L, 0x65b0d9c6L, 0x12b7e950L,
|
|
|
|
0x8bbeb8eaL, 0xfcb9887cL, 0x62dd1ddfL, 0x15da2d49L, 0x8cd37cf3L,
|
|
|
|
0xfbd44c65L, 0x4db26158L, 0x3ab551ceL, 0xa3bc0074L, 0xd4bb30e2L,
|
|
|
|
0x4adfa541L, 0x3dd895d7L, 0xa4d1c46dL, 0xd3d6f4fbL, 0x4369e96aL,
|
|
|
|
0x346ed9fcL, 0xad678846L, 0xda60b8d0L, 0x44042d73L, 0x33031de5L,
|
|
|
|
0xaa0a4c5fL, 0xdd0d7cc9L, 0x5005713cL, 0x270241aaL, 0xbe0b1010L,
|
|
|
|
0xc90c2086L, 0x5768b525L, 0x206f85b3L, 0xb966d409L, 0xce61e49fL,
|
|
|
|
0x5edef90eL, 0x29d9c998L, 0xb0d09822L, 0xc7d7a8b4L, 0x59b33d17L,
|
|
|
|
0x2eb40d81L, 0xb7bd5c3bL, 0xc0ba6cadL, 0xedb88320L, 0x9abfb3b6L,
|
|
|
|
0x03b6e20cL, 0x74b1d29aL, 0xead54739L, 0x9dd277afL, 0x04db2615L,
|
|
|
|
0x73dc1683L, 0xe3630b12L, 0x94643b84L, 0x0d6d6a3eL, 0x7a6a5aa8L,
|
|
|
|
0xe40ecf0bL, 0x9309ff9dL, 0x0a00ae27L, 0x7d079eb1L, 0xf00f9344L,
|
|
|
|
0x8708a3d2L, 0x1e01f268L, 0x6906c2feL, 0xf762575dL, 0x806567cbL,
|
|
|
|
0x196c3671L, 0x6e6b06e7L, 0xfed41b76L, 0x89d32be0L, 0x10da7a5aL,
|
|
|
|
0x67dd4accL, 0xf9b9df6fL, 0x8ebeeff9L, 0x17b7be43L, 0x60b08ed5L,
|
|
|
|
0xd6d6a3e8L, 0xa1d1937eL, 0x38d8c2c4L, 0x4fdff252L, 0xd1bb67f1L,
|
|
|
|
0xa6bc5767L, 0x3fb506ddL, 0x48b2364bL, 0xd80d2bdaL, 0xaf0a1b4cL,
|
|
|
|
0x36034af6L, 0x41047a60L, 0xdf60efc3L, 0xa867df55L, 0x316e8eefL,
|
|
|
|
0x4669be79L, 0xcb61b38cL, 0xbc66831aL, 0x256fd2a0L, 0x5268e236L,
|
|
|
|
0xcc0c7795L, 0xbb0b4703L, 0x220216b9L, 0x5505262fL, 0xc5ba3bbeL,
|
|
|
|
0xb2bd0b28L, 0x2bb45a92L, 0x5cb36a04L, 0xc2d7ffa7L, 0xb5d0cf31L,
|
|
|
|
0x2cd99e8bL, 0x5bdeae1dL, 0x9b64c2b0L, 0xec63f226L, 0x756aa39cL,
|
|
|
|
0x026d930aL, 0x9c0906a9L, 0xeb0e363fL, 0x72076785L, 0x05005713L,
|
|
|
|
0x95bf4a82L, 0xe2b87a14L, 0x7bb12baeL, 0x0cb61b38L, 0x92d28e9bL,
|
|
|
|
0xe5d5be0dL, 0x7cdcefb7L, 0x0bdbdf21L, 0x86d3d2d4L, 0xf1d4e242L,
|
|
|
|
0x68ddb3f8L, 0x1fda836eL, 0x81be16cdL, 0xf6b9265bL, 0x6fb077e1L,
|
|
|
|
0x18b74777L, 0x88085ae6L, 0xff0f6a70L, 0x66063bcaL, 0x11010b5cL,
|
|
|
|
0x8f659effL, 0xf862ae69L, 0x616bffd3L, 0x166ccf45L, 0xa00ae278L,
|
|
|
|
0xd70dd2eeL, 0x4e048354L, 0x3903b3c2L, 0xa7672661L, 0xd06016f7L,
|
|
|
|
0x4969474dL, 0x3e6e77dbL, 0xaed16a4aL, 0xd9d65adcL, 0x40df0b66L,
|
|
|
|
0x37d83bf0L, 0xa9bcae53L, 0xdebb9ec5L, 0x47b2cf7fL, 0x30b5ffe9L,
|
|
|
|
0xbdbdf21cL, 0xcabac28aL, 0x53b39330L, 0x24b4a3a6L, 0xbad03605L,
|
|
|
|
0xcdd70693L, 0x54de5729L, 0x23d967bfL, 0xb3667a2eL, 0xc4614ab8L,
|
|
|
|
0x5d681b02L, 0x2a6f2b94L, 0xb40bbe37L, 0xc30c8ea1L, 0x5a05df1bL,
|
|
|
|
0x2d02ef8dL};
|
|
|
|
|
|
|
|
unsigned long CRC32checksum(const char *seq, const long seqlen,
|
|
|
|
unsigned long *checktotal)
|
|
|
|
/*CRC32checksum: modified from CRC-32 algorithm found in ZIP compression source
|
|
|
|
*/
|
|
|
|
{
|
|
|
|
register unsigned long c = 0xffffffffL;
|
|
|
|
register long n = seqlen;
|
|
|
|
|
|
|
|
while (n--) {
|
|
|
|
c = crctab[((int)c ^ (to_upper(*seq))) & 0xff] ^ (c >> 8);
|
|
|
|
seq++; /* fixed aug'98 finally */
|
|
|
|
}
|
|
|
|
c = c ^ 0xffffffffL;
|
|
|
|
*checktotal += c;
|
|
|
|
return c;
|
|
|
|
}
|
|
|
|
|
|
|
|
short getseqtype(const char *seq, const long seqlen)
|
|
|
|
{ /* return sequence kind: kDNA, kRNA, kProtein, kOtherSeq, ??? */
|
|
|
|
char c;
|
|
|
|
short i, maxtest;
|
|
|
|
short na = 0, aa = 0, po = 0, nt = 0, nu = 0, ns = 0, no = 0;
|
|
|
|
|
|
|
|
maxtest = min(300, seqlen);
|
|
|
|
for (i = 0; i < maxtest; i++) {
|
|
|
|
c = to_upper(seq[i]);
|
|
|
|
if (strchr(protonly, c))
|
|
|
|
po++;
|
|
|
|
else if (strchr(primenuc, c)) {
|
|
|
|
na++;
|
|
|
|
if (c == 'T')
|
|
|
|
nt++;
|
|
|
|
else if (c == 'U')
|
|
|
|
nu++;
|
|
|
|
}
|
|
|
|
else if (strchr(aminos, c))
|
|
|
|
aa++;
|
|
|
|
else if (strchr(seqsymbols, c))
|
|
|
|
ns++;
|
|
|
|
else if (isalpha(c))
|
|
|
|
no++;
|
|
|
|
}
|
|
|
|
|
|
|
|
if ((no > 0) || (po + aa + na == 0)) return kOtherSeq;
|
|
|
|
/* ?? test for probability of kOtherSeq ?, e.g.,
|
|
|
|
else if (po+aa+na / maxtest < 0.70) return kOtherSeq;
|
|
|
|
*/
|
|
|
|
else if (po > 0)
|
|
|
|
return kAmino;
|
|
|
|
else if (aa == 0) {
|
|
|
|
if (nu > nt)
|
|
|
|
return kRNA;
|
|
|
|
else
|
|
|
|
return kDNA;
|
|
|
|
}
|
|
|
|
else if (na > aa)
|
|
|
|
return kNucleic;
|
|
|
|
else
|
|
|
|
return kAmino;
|
|
|
|
} /* getseqtype */
|
|
|
|
|
|
|
|
char *compressSeq(const char gapc, const char *seq, const long seqlen,
|
|
|
|
long *newlen)
|
|
|
|
{
|
|
|
|
register char *a, *b;
|
|
|
|
register long i;
|
|
|
|
char *newseq;
|
|
|
|
|
|
|
|
*newlen = 0;
|
|
|
|
if (!seq) return NULL;
|
|
|
|
newseq = (char *)malloc(seqlen + 1);
|
|
|
|
if (!newseq) return NULL;
|
|
|
|
for (a = (char *)seq, b = newseq, i = 0; *a != 0; a++)
|
|
|
|
if (*a != gapc) {
|
|
|
|
*b++ = *a;
|
|
|
|
i++;
|
|
|
|
}
|
|
|
|
*b = '\0';
|
|
|
|
newseq = (char *)realloc(newseq, i + 1);
|
|
|
|
*newlen = i;
|
|
|
|
return newseq;
|
|
|
|
}
|
|
|
|
|
|
|
|
/***
|
|
|
|
char *rtfhead = "{\\rtf1\\defformat\\mac\\deff2 \
|
|
|
|
{\\fonttbl\
|
|
|
|
{\\f1\\fmodern Courier;}{\\f2\\fmodern Monaco;}\
|
|
|
|
{\\f3\\fswiss Helvetica;}{\\f4\\fswiss Geneva;}\
|
|
|
|
{\\f5\\froman Times;}{\\f6\\froman Palatino;}\
|
|
|
|
{\\f7\\froman New Century Schlbk;}{\\f8\\ftech Symbol;}}\
|
|
|
|
{\\stylesheet\
|
|
|
|
{\\s1 \\f5\\fs20 \\sbasedon0\\snext1 name;}\
|
|
|
|
{\\s2 \\f3\\fs20 \\sbasedon0\\snext2 num;}\
|
|
|
|
{\\s3 \\f1\\f21 \\sbasedon0\\snext3 seq;}}";
|
|
|
|
|
|
|
|
char *rtftail = "}";
|
|
|
|
****/
|
|
|
|
|
|
|
|
short writeSeq(FILE *outf, const char *seq, const long seqlen,
|
|
|
|
const short outform, const char *seqid)
|
|
|
|
/* dump sequence to standard output */
|
|
|
|
{
|
|
|
|
const short kSpaceAll = -9;
|
|
|
|
#define kMaxseqwidth 250
|
|
|
|
|
|
|
|
boolean baseonlynum =
|
|
|
|
false; /* nocountsymbols -- only count true bases, not "-" */
|
|
|
|
short numline = 0; /* only true if we are writing seq number line (for
|
|
|
|
interleave) */
|
|
|
|
boolean numright = false, numleft = false;
|
|
|
|
boolean nameright = false, nameleft = false;
|
|
|
|
short namewidth = 8, numwidth = 8;
|
|
|
|
short spacer = 0, width = 50, tab = 0;
|
|
|
|
/* new parameters: width, spacer, those above... */
|
|
|
|
|
|
|
|
short linesout = 0, seqtype = kNucleic;
|
|
|
|
long i, j, l, l1, ibase;
|
|
|
|
char idword[31], endstr[10];
|
|
|
|
char seqnamestore[128], *seqname = seqnamestore;
|
|
|
|
char s[kMaxseqwidth], *cp;
|
|
|
|
char nameform[10], numform[10], nocountsymbols[10];
|
|
|
|
unsigned long checksum = 0, checktotal = 0;
|
|
|
|
|
|
|
|
gPretty.atseq++;
|
|
|
|
skipwhitespace(seqid);
|
|
|
|
l = min(128, strlen(seqid));
|
|
|
|
strncpy(seqnamestore, seqid, l);
|
|
|
|
seqname[l] = 0;
|
|
|
|
|
|
|
|
sscanf(seqname, "%30s", idword);
|
|
|
|
sprintf(numform, "%d", seqlen);
|
|
|
|
numwidth = strlen(numform) + 1;
|
|
|
|
nameform[0] = '\0';
|
|
|
|
|
|
|
|
if (strstr(seqname, "checksum") != NULL) {
|
|
|
|
cp = strstr(seqname, "bases");
|
|
|
|
if (cp != NULL) {
|
|
|
|
for (; (cp != seqname) && (*cp != ','); cp--)
|
|
|
|
;
|
|
|
|
if (cp != seqname) *cp = 0;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
strcpy(endstr, "");
|
|
|
|
l1 = 0;
|
|
|
|
|
|
|
|
if (outform == kGCG || outform == kMSF)
|
|
|
|
checksum = GCGchecksum(seq, seqlen, &checktotal);
|
|
|
|
else
|
|
|
|
checksum = seqchecksum(seq, seqlen, &checktotal);
|
|
|
|
|
|
|
|
switch (outform) {
|
|
|
|
case kPlain:
|
|
|
|
case kUnknown: /* no header, just sequence */
|
|
|
|
strcpy(endstr, "\n"); /* end w/ extra blank line */
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kOlsen: /* Olsen seq. editor takes plain nucs OR Genbank */
|
|
|
|
case kGenBank:
|
|
|
|
fprintf(outf, "LOCUS %s %d bp\n", idword,
|
|
|
|
seqlen);
|
|
|
|
fprintf(outf,
|
|
|
|
"DEFINITION %s, %d bases, %X checksum.\n",
|
|
|
|
seqname, seqlen, checksum);
|
|
|
|
/* fprintf(outf,"ACCESSION %s\n", accnum); */
|
|
|
|
fprintf(outf, "ORIGIN \n");
|
|
|
|
spacer = 11;
|
|
|
|
numleft = true;
|
|
|
|
numwidth = 8; /* dgg. 1Feb93, patch for GDE fail to read
|
|
|
|
short numwidth */
|
|
|
|
strcpy(endstr, "\n//");
|
|
|
|
linesout += 4;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kPIR:
|
|
|
|
/* somewhat like genbank... \\\*/
|
|
|
|
/* fprintf(outf,"\\\\\\\n"); << only at top of file, not
|
|
|
|
* each entry... */
|
|
|
|
fprintf(outf, "ENTRY %s \n", idword);
|
|
|
|
fprintf(outf,
|
|
|
|
"TITLE %s, %d bases, %X checksum.\n",
|
|
|
|
seqname, seqlen, checksum);
|
|
|
|
/* fprintf(outf,"ACCESSION %s\n", accnum); */
|
|
|
|
fprintf(outf, "SEQUENCE \n");
|
|
|
|
numwidth = 7;
|
|
|
|
width = 30;
|
|
|
|
spacer = kSpaceAll;
|
|
|
|
numleft = true;
|
|
|
|
strcpy(endstr, "\n///");
|
|
|
|
/* run a top number line for PIR */
|
|
|
|
for (j = 0; j < numwidth; j++) fputc(' ', outf);
|
|
|
|
for (j = 5; j <= width; j += 5)
|
|
|
|
fprintf(outf, "%10d", j);
|
|
|
|
fputc('\n', outf);
|
|
|
|
linesout += 5;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kNBRF:
|
|
|
|
if (getseqtype(seq, seqlen) == kAmino)
|
|
|
|
fprintf(outf, ">P1;%s\n", idword);
|
|
|
|
else
|
|
|
|
fprintf(outf, ">DL;%s\n", idword);
|
|
|
|
fprintf(outf, "%s, %d bases, %X checksum.\n", seqname,
|
|
|
|
seqlen, checksum);
|
|
|
|
spacer = 11;
|
|
|
|
strcpy(endstr, "*\n");
|
|
|
|
linesout += 3;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kEMBL:
|
|
|
|
fprintf(outf, "ID %s\n", idword);
|
|
|
|
/* fprintf(outf,"AC %s\n", accnum); */
|
|
|
|
fprintf(outf, "DE %s, %d bases, %X checksum.\n",
|
|
|
|
seqname, seqlen, checksum);
|
|
|
|
fprintf(outf, "SQ %d BP\n", seqlen);
|
|
|
|
strcpy(endstr, "\n//"); /* 11Oct90: bug fix*/
|
|
|
|
tab = 4; /** added 31jan91 */
|
|
|
|
spacer = 11; /** added 31jan91 */
|
|
|
|
width = 60;
|
|
|
|
linesout += 4;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kGCG:
|
|
|
|
fprintf(outf, "%s\n", seqname);
|
|
|
|
/* fprintf(outf,"ACCESSION %s\n", accnum); */
|
|
|
|
fprintf(outf,
|
|
|
|
" %s Length: %d (today) Check: %d ..\n",
|
|
|
|
idword, seqlen, checksum);
|
|
|
|
spacer = 11;
|
|
|
|
numleft = true;
|
|
|
|
strcpy(endstr, "\n"); /* this is insurance to help
|
|
|
|
prevent misreads at eof */
|
|
|
|
linesout += 3;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kStrider: /* ?? map ?*/
|
|
|
|
fprintf(outf, "; ### from DNA Strider ;-)\n");
|
|
|
|
fprintf(
|
|
|
|
outf,
|
|
|
|
"; DNA sequence %s, %d bases, %X checksum.\n;\n",
|
|
|
|
seqname, seqlen, checksum);
|
|
|
|
strcpy(endstr, "\n//");
|
|
|
|
linesout += 3;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kFitch:
|
|
|
|
fprintf(outf, "%s, %d bases, %X checksum.\n", seqname,
|
|
|
|
seqlen, checksum);
|
|
|
|
spacer = 4;
|
|
|
|
width = 60;
|
|
|
|
linesout += 1;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kPhylip2:
|
|
|
|
case kPhylip4:
|
|
|
|
/* this is version 3.2/3.4 -- simplest way to write
|
|
|
|
version 3.3 is to write as version 3.2, then
|
|
|
|
re-read file and interleave the species lines */
|
|
|
|
if (strlen(idword) > 10) idword[10] = 0;
|
|
|
|
fprintf(outf, "%-10s ", idword);
|
|
|
|
l1 = -1;
|
|
|
|
tab = 12;
|
|
|
|
spacer = 11;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kASN1:
|
|
|
|
seqtype = getseqtype(seq, seqlen);
|
|
|
|
switch (seqtype) {
|
|
|
|
case kDNA:
|
|
|
|
cp = "dna";
|
|
|
|
break;
|
|
|
|
case kRNA:
|
|
|
|
cp = "rna";
|
|
|
|
break;
|
|
|
|
case kNucleic:
|
|
|
|
cp = "na";
|
|
|
|
break;
|
|
|
|
case kAmino:
|
|
|
|
cp = "aa";
|
|
|
|
break;
|
|
|
|
case kOtherSeq:
|
|
|
|
cp = "not-set";
|
|
|
|
break;
|
|
|
|
}
|
|
|
|
fprintf(outf, " seq {\n");
|
|
|
|
fprintf(outf, " id { local id %d },\n",
|
|
|
|
gPretty.atseq);
|
|
|
|
fprintf(outf, " descr { title \"%s\" },\n", seqid);
|
|
|
|
fprintf(outf, " inst {\n");
|
|
|
|
fprintf(outf,
|
|
|
|
" repr raw, mol %s, length %d, topology "
|
|
|
|
"linear,\n",
|
|
|
|
cp, seqlen);
|
|
|
|
fprintf(outf, " seq-data\n");
|
|
|
|
if (seqtype == kAmino)
|
|
|
|
fprintf(outf, " iupacaa \"");
|
|
|
|
else
|
|
|
|
fprintf(outf, " iupacna \"");
|
|
|
|
l1 = 17;
|
|
|
|
spacer = 0;
|
|
|
|
width = 78;
|
|
|
|
tab = 0;
|
|
|
|
strcpy(endstr, "\"\n } } ,");
|
|
|
|
linesout += 7;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kPAUP:
|
|
|
|
nameleft = true;
|
|
|
|
namewidth = 9;
|
|
|
|
spacer = 21;
|
|
|
|
width = 100;
|
|
|
|
tab = 0; /* 1; */
|
|
|
|
/* strcpy(endstr,";\nend;"); << this is end of all
|
|
|
|
* seqs.. */
|
|
|
|
/* do a header comment line for paup */
|
|
|
|
fprintf(outf, "[Name: %-16s Len:%6d Check: %8X]\n",
|
|
|
|
idword, seqlen, checksum);
|
|
|
|
linesout += 1;
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kPretty:
|
|
|
|
numline = gPretty.numline;
|
|
|
|
baseonlynum = gPretty.baseonlynum;
|
|
|
|
namewidth = gPretty.namewidth;
|
|
|
|
numright = gPretty.numright;
|
|
|
|
numleft = gPretty.numleft;
|
|
|
|
nameright = gPretty.nameright;
|
|
|
|
nameleft = gPretty.nameleft;
|
|
|
|
spacer = gPretty.spacer + 1;
|
|
|
|
width = gPretty.seqwidth;
|
|
|
|
tab = gPretty.tab;
|
|
|
|
/* also add rtf formatting w/ font, size, style */
|
|
|
|
if (gPretty.nametop) {
|
|
|
|
fprintf(outf,
|
|
|
|
"Name: %-16s Len:%6d Check: %8X\n",
|
|
|
|
idword, seqlen, checksum);
|
|
|
|
linesout++;
|
|
|
|
}
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kMSF:
|
|
|
|
fprintf(
|
|
|
|
outf,
|
|
|
|
" Name: %-16s Len:%6d Check: %5d Weight: 1.00\n",
|
|
|
|
idword, seqlen, checksum);
|
|
|
|
linesout++;
|
|
|
|
nameleft = true;
|
|
|
|
namewidth = 15; /* need MAX namewidth here... */
|
|
|
|
sprintf(nameform, "%%+%ds ", namewidth);
|
|
|
|
spacer = 11;
|
|
|
|
width = 50;
|
|
|
|
tab = 0; /* 1; */
|
|
|
|
break;
|
|
|
|
|
|
|
|
case kIG:
|
|
|
|
fprintf(outf, ";%s, %d bases, %X checksum.\n", seqname,
|
|
|
|
seqlen, checksum);
|
|
|
|
fprintf(outf, "%s\n", idword);
|
|
|
|
strcpy(endstr, "1"); /* == linear dna */
|
|
|
|
linesout += 2;
|
|
|
|
break;
|
|
|
|
|
|
|
|
default:
|
|
|
|
case kZuker: /* don't attempt Zuker's ftn format */
|
|
|
|
case kPearson:
|
|
|
|
fprintf(outf, ">%s, %d bases, %X checksum.\n", seqname,
|
|
|
|
seqlen, checksum);
|
|
|
|
linesout += 1;
|
|
|
|
break;
|
|
|
|
}
|
|
|
|
|
|
|
|
if (*nameform == 0)
|
|
|
|
sprintf(nameform, "%%%d.%ds ", namewidth, namewidth);
|
|
|
|
if (numline)
|
|
|
|
sprintf(numform, "%%%ds ", numwidth);
|
|
|
|
else
|
|
|
|
sprintf(numform, "%%%dd ", numwidth);
|
|
|
|
strcpy(nocountsymbols, kNocountsymbols);
|
|
|
|
if (baseonlynum) {
|
|
|
|
if (strchr(nocountsymbols, gPretty.gapchar) == NULL) {
|
|
|
|
strcat(nocountsymbols, " ");
|
|
|
|
nocountsymbols[strlen(nocountsymbols) - 1] =
|
|
|
|
gPretty.gapchar;
|
|
|
|
}
|
|
|
|
if (gPretty.domatch &&
|
|
|
|
(cp = strchr(nocountsymbols, gPretty.matchchar)) != NULL) {
|
|
|
|
*cp = ' ';
|
|
|
|
}
|
|
|
|
}
|
|
|
|
|
|
|
|
if (numline) {
|
|
|
|
*idword = 0;
|
|
|
|
}
|
|
|
|
|
|
|
|
width = min(width, kMaxseqwidth);
|
|
|
|
for (i = 0, l = 0, ibase = 1; i < seqlen;) {
|
|
|
|
if (l1 < 0)
|
|
|
|
l1 = 0;
|
|
|
|
else if (l1 == 0) {
|
|
|
|
if (nameleft) fprintf(outf, nameform, idword);
|
|
|
|
if (numleft) {
|
|
|
|
if (numline)
|
|
|
|
fprintf(outf, numform, "");
|
|
|
|
else
|
|
|
|
fprintf(outf, numform, ibase);
|
|
|
|
}
|
|
|
|
for (j = 0; j < tab; j++) fputc(' ', outf);
|
|
|
|
}
|
|
|
|
|
|
|
|
l1++; /* don't count spaces for width*/
|
|
|
|
if (numline) {
|
|
|
|
if (spacer == kSpaceAll ||
|
|
|
|
(spacer != 0 && (l + 1) % spacer == 1)) {
|
|
|
|
if (numline == 1) fputc(' ', outf);
|
|
|
|
s[l++] = ' ';
|
|
|
|
}
|
|
|
|
if (l1 % 10 == 1 || l1 == width) {
|
|
|
|
if (numline == 1) fprintf(outf, "%-9d ", i + 1);
|
|
|
|
s[l++] = '|'; /* == put a number here */
|
|
|
|
}
|
|
|
|
else
|
|
|
|
s[l++] = ' ';
|
|
|
|
i++;
|
|
|
|
}
|
|
|
|
|
|
|
|
else {
|
|
|
|
if (spacer == kSpaceAll ||
|
|
|
|
(spacer != 0 && (l + 1) % spacer == 1))
|
|
|
|
s[l++] = ' ';
|
|
|
|
if (!baseonlynum)
|
|
|
|
ibase++;
|
|
|
|
else if (0 == strchr(nocountsymbols, seq[i]))
|
|
|
|
ibase++;
|
|
|
|
s[l++] = seq[i++];
|
|
|
|
}
|
|
|
|
|
|
|
|
if (l1 == width || i == seqlen) {
|
|
|
|
if (outform == kPretty)
|
|
|
|
for (; l1 < width; l1++) {
|
|
|
|
if (spacer == kSpaceAll ||
|
|
|
|
(spacer != 0 &&
|
|
|
|
(l + 1) % spacer == 1))
|
|
|
|
s[l++] = ' ';
|
|
|
|
s[l++] = ' '; /* pad w/ blanks */
|
|
|
|
}
|
|
|
|
s[l] = '\0';
|
|
|
|
l = 0;
|
|
|
|
l1 = 0;
|
|
|
|
|
|
|
|
if (numline) {
|
|
|
|
if (numline == 2)
|
|
|
|
fprintf(
|
|
|
|
outf, "%s",
|
|
|
|
s); /* finish numberline ! and | */
|
|
|
|
}
|
|
|
|
else {
|
|
|
|
if (i == seqlen)
|
|
|
|
fprintf(outf, "%s%s", s, endstr);
|
|
|
|
else
|
|
|
|
fprintf(outf, "%s", s);
|
|
|
|
if (numright || nameright) fputc(' ', outf);
|
|
|
|
if (numright) fprintf(outf, numform, ibase - 1);
|
|
|
|
if (nameright) fprintf(outf, nameform, idword);
|
|
|
|
}
|
|
|
|
fputc('\n', outf);
|
|
|
|
linesout++;
|
|
|
|
}
|
|
|
|
}
|
|
|
|
return linesout;
|
|
|
|
} /*writeSeq*/
|
|
|
|
|
|
|
|
/* End file: ureadseq.c */
|