diff --git a/GDE2.0_manual.ps b/GDE2.0_manual.ps
deleted file mode 100755
index a9b90c8..0000000
--- a/GDE2.0_manual.ps
+++ /dev/null
@@ -1,6258 +0,0 @@
-%!
-%%Title: "Laser Prep -- The Apple PostScript Dictionary (md)"
-%%Creator: Apple Software Engineering
-%%CreationDate: Thursday, March 19, 1987
-%{appledict version #70 0
-% ) CopyRight Apple Computer, Inc. 1984-89 All Rights Reserved.
-%%EndComments
-%%BeginProcSet: "(AppleDict md)" 70 0
-statusdict begin product(LaserWriter II NT)eq revision 1 eq and
-{userdict begin/oldcds/cleardictstack load def/cleardictstack{31 sendpcmd 4 eq tonerlight/oldcds load exec}bind def
-end
-currentfile eexec
-}{save currentfile 359 string readhexstring pop pop restore}ifelse
-35de8eabfc7fa5eac0431edc501ad43f5fcbdf9fdd321cce93b525f4439dd94696bf56ac13a0a2aad1e6bcf444711e941d7217138d20ae0500145f815439cc14e697ad201df728ea4ccad4ac
-331aa03a7aacde10760bf4ee12bbf73c77cdcbf1796f26f0dd255d2407e1ac41
-d27489a69d6b69c6a841468b46720b75ad65650700e0c528e7af61e7e3e821b59445c44b69831ebc9deaf0e3aecc14b7a1c2e18bc1fa42a59219f1e36f236e3d6c89114b1f231999c3dbce6b43f3e2918fcb85575941a9d1e65c86aa08e6eea86cc66ce90e5e4add57f2585e
-7b1c0b5203cfc46868d6e3c0d66db79174e7091e32e307679732da062e440e41dabd36a161b611a7e4523a49694026206803dbfd5be5c5fe433f0f18a40057db6f1302848c8da4a10a7f14c6
-3d512806362b1be092ad5dbd36d75fe63e4cae2ba9b72390f580cac344a08bdf6eb9e36ec45bad2a0b82829a72e0efa2d87332c482196e690361168271c55053341ab3
-end
-/sc {60 45 {abs exch abs 2 copy add 1 gt{1.0 sub dup mul exch 1.0 sub dup mul add 1.0 sub}{dup mul exch dup mul add 1.0 exch sub}
-ifelse}setscreen} bind def statusdict begin product(LaserWriter II)anchorsearch end
-{pop pop/letter [/letter load /exec load /sc load /exec load]cvx def/legal [/legal load /exec load /sc load /exec load]cvx def/a4 [/a4 load /exec load /sc load /exec load]cvx def/b5 [/b5 load /exec load /sc load /exec load]cvx def
-/lettersmall [/lettersmall load /exec load /sc load /exec load]cvx def/a4small [/a4small load /exec load /sc load /exec load]cvx def/note [/note load /exec load /sc load /exec load]cvx def}{pop}ifelse
-systemdict/currentpacking known{currentpacking true setpacking}if
-/LW{save statusdict/product get(LaserWriter)anchorsearch
-exch pop{length 0 eq{1}{2}ifelse}{0}ifelse exch restore}bind def
-/LW+{LW 2 eq}bind def
-/ok{systemdict/statusdict known dup{LW 0 gt and}if}bind def
-ok{statusdict begin 9 sccinteractive 3 ne exch 0 ne or{9 0 3 setsccinteractive}if end}if
-/md 270 dict def md begin
-/av 0 def
-/T true def/F false def/mtx matrix def/s75 75 string def/sa8 8 string def/sb8 8 string def
-/sc8 8 string def/sd8 8 string def/s1 ( ) def/pxs 1 def/pys 1 def
-/ns false def
-1 0 mtx defaultmatrix dtransform exch atan/pa exch def/nlw .24 def/ppr [-32 -29.52 762 582.48] def
-/pgr [0 0 0 0] def
-/pgs 1 def/por true def/xb 500 array def/so true def/tso true def/fillflag false def/pnm 1 def/fmv true def
-/sfl false def/ma 0 def/invertflag false def/dbinvertflag false def/xflip false def/yflip false def/noflips true def/scaleby96 false def/fNote true def/fBitStretch true def
-/4colors false def/3colors false def/2colors false def
-/wtkey false def
-statusdict begin/waittimeout where{pop waittimeout 300 lt{md /wtkey true put}if}if end
-wtkey{statusdict begin/setdefaulttimeouts where{pop 0 60 300 setdefaulttimeouts}if end}if
-/fg (Rvd\001\001\000\000\177) def
-/bdf{bind def}bind def
-/xdf{exch def}bdf
-/xl{neg exch neg translate}bdf
-/fp{pnsh 0 ne pnsv 0 ne and}bdf
-/nop{}bdf/lnop[/nop load]cvx bdf
-/vrb[
-{fp{fg 6 get 0 ne{gsave stroke grestore}{gsave 1 setlinewidth pnsh pnsv scale stroke grestore}ifelse}if newpath}bind
-/eofill load
-dup
-/newpath load
-2 index
-dup
-{clip newpath}bind
-{}bind
-dup
-2 copy
-]def
-systemdict/currentcolorscreen known{currentcolorscreen/dkspf xdf/dkrot xdf/dkfreq xdf/dyspf xdf/dyrot xdf/dyfreq xdf/dmspf xdf/dmrot xdf/dmfreq xdf
-/dcspf xdf/dcrot xdf/dcfreq xdf}{currentscreen/spf xdf/rot xdf/freq xdf}ifelse
-/doop{vrb exch get exec}bdf
-/psu{/udf xdf/tso xdf /fNote xdf/fBitStretch xdf/scaleby96 xdf/yflip xdf/xflip xdf
-/invertflag xdf/dbinvertflag invertflag statusdict begin version cvr 47.0 ge product (LaserWriter) eq not and end invertflag and {not}if def
-xflip yflip or{/noflips false def}if
-/pgs xdf 2 index .72 mul exch div/pys xdf div .72 mul/pxs xdf ppr astore pop pgr astore pop/por xdf sn and/so xdf}bdf
-/tab{statusdict /11x17 known{statusdict begin /11x17 load end}{statusdict /setpage known{statusdict begin 792 1224 1 setpage end}{statusdict /setpageparams known{statusdict begin 792 1224 0 1 setpageparams end}if}ifelse}ifelse}bdf
-/a3Size{statusdict /a3 known{statusdict begin /a3 load end}{statusdict /setpageparams known{statusdict begin 842 1191 0 1 setpageparams end}if}ifelse}bdf
-/txpose{fNote{smalls}{bigs}ifelse pgs get exec pxs pys scale ppr aload pop por{noflips{pop exch neg exch translate pop 1 -1 scale}if
-xflip yflip and{pop exch neg exch translate 180 rotate 1 -1 scale ppr 3 get ppr 1 get neg sub neg ppr 2 get ppr 0 get neg sub neg translate}if
-xflip yflip not and{pop exch neg exch translate pop 180 rotate ppr 3 get ppr 1 get neg sub neg 0 translate}if yflip xflip not and{ppr 1 get neg ppr 0 get neg translate}if}
-{noflips{translate pop pop 270 rotate 1 -1 scale}if xflip yflip and{translate pop pop 90 rotate 1 -1 scale ppr 3 get ppr 1 get neg sub neg ppr 2 get ppr 0 get neg sub neg translate}if
-xflip yflip not and{translate pop pop 90 rotate ppr 3 get ppr 1 get neg sub neg 0 translate}if yflip xflip not and{translate pop pop 270 rotate ppr 2 get ppr 0 get neg sub neg 0 exch translate}if}ifelse
-wtkey{statusdict/waittimeout 300 put}if
-scaleby96{ppr aload pop 4 -1 roll add 2 div 3 1 roll add 2 div 2 copy translate .96 dup scale neg exch neg exch translate}if}bdf
-/fr{4 copy pgr aload pop 3 -1 roll add 3 1 roll exch add 6 2 roll 3 -1 roll
-sub 3 1 roll exch sub 3 -1 roll exch div 3 1 roll div exch scale pop pop xl}bdf
-/obl{{0.212557 mul}{pop 0}ifelse}bdf
-/sfd{ps fg 5 -1 roll get mul 100 div 0 ps 5 -1 roll obl ps neg 0 0 6a astore makefont setfont}bdf
-/fnt{findfont sfd}bdf
-/bt{sa 3 1 roll 3 index and put}bdf
-/sa(\000\000\000\000\000\000\000\000\000\000)def
-/fs{0 1 bt 1 2 bt 2 4 bt 3 8 bt 4 16 bt 5 32 bt 6 64 bt 7 128 bt sa exch 8 exch put}bdf
-/mx1 matrix def
-/mx2 matrix def
-/mx3 matrix def
-/bu{currentpoint 4colors{currentcmykcolor}{currentrgbcolor}ifelse currentlinewidth currentlinecap currentlinejoin
-currentdash exch aload length fg 5 sfl{1}{0}ifelse put pnsv pnsh
-2t aload pop 3a aload pop mx2 aload pop mx1 aload pop mtx currentmatrix aload pop
-mx3 aload pop ps pm restore/ps xdf mx3 astore pop}bdf
-/bn{/pm save def mx3 setmatrix newpath 0 0 moveto ct dup 39 get 0 exch getinterval cvx exec mtx astore setmatrix mx1 astore pop mx2 astore pop 3a
-astore pop 2t astore pop/pnsh xdf/pnsv xdf gw
-/sfl fg 5 get 0 ne def array astore exch setdash setlinejoin setlinecap
-setlinewidth 4colors{setcmykcolor}{setrgbcolor}ifelse moveto}bdf
-/fc{save vmstatus exch sub 50000 lt
-{(%%[|0|]%%)=print flush}if pop restore}bdf
-/tc{32768 div add 3 1 roll 32768 div add 2t astore pop}bdf
-/3a [0 0 0] def
-/2t 2 array def
-/tp{3a astore pop}bdf
-/tt{mx2 currentmatrix pop currentpoint 2 copy 2t aload pop qa 2 copy translate 3a aload pop exch dup 0 eq
-{pop}{1 eq{-1 1}{1 -1}ifelse scale}ifelse rotate pop neg exch neg exch translate moveto}bdf
-/te{mx2 setmatrix}bdf
-/th{3 -1 roll div 3 1 roll exch div 2 copy mx1 scale pop scale/sfl true def}bdf
-/tu{1 1 mx1 itransform scale/sfl false def}bdf
-/ts{1 1 mx1 transform scale/sfl true def}bdf
-/fz{/ps xdf}bdf
-/dv{dup 0 ne{div}{pop}ifelse}bdf
-/pop4{pop pop pop pop}bdf
-/it{sfl{mx1 itransform}if}bdf
-/gm{exch it moveto}bdf/rm{it rmoveto}bdf
-/lm{currentpoint sfl{mx1 transform}if exch pop sub 0 exch it rmoveto}bdf
-/fm{statusdict/manualfeed known}bdf
-/se{statusdict exch/manualfeed exch put}bdf
-/mf{dup/ma exch def 0 gt{fm se/t1 5 st ok ma 1 gt and{/t2 0 st/t3 0 st
-statusdict/manualfeedtimeout 3600 put
-}if}if}bdf
-/jn{/statusdict where exch pop{statusdict exch /jobname exch put}if}bdf
-/pen{pnm mul/pnsh xdf pnm mul/pnsv xdf pnsh setlinewidth}bdf
-/min{2 copy gt{exch}if pop}bdf
-/max{2 copy lt{exch}if pop}bdf
-/dh{fg 6 1 put array astore dup {1 pxs div mul exch}forall astore exch pop exch pop exch setdash}bdf
-/ih[currentdash]def
-/rh{fg 6 0 put ih aload pop setdash}bdf
-/dl{gsave nlw pys div setlinewidth 0 setgray}bdf
-/dlin{exch currentpoint currentlinewidth 2 div dup
-translate newpath moveto lineto currentpoint stroke grestore moveto}bdf
-/lin{fg 6 get 0 ne{exch lineto currentpoint 0 doop moveto}
-{exch currentpoint/pnlv xdf/pnlh xdf gsave newpath/@1 xdf/@2 xdf fp{pnlh @2 lt{pnlv @1 ge
-{pnlh pnlv moveto @2 @1 lineto pnsh 0 rlineto
-0 pnsv rlineto pnlh pnsh add pnlv pnsv add lineto pnsh neg 0 rlineto}
-{pnlh pnlv moveto pnsh 0 rlineto @2 pnsh add @1 lineto 0 pnsv rlineto
-pnsh neg 0 rlineto pnlh pnlv pnsv add lineto}ifelse}{pnlv @1 gt
-{@2 @1 moveto pnsh 0 rlineto pnlh pnsh add pnlv lineto 0 pnsv rlineto
-pnsh neg 0 rlineto @2 @1 pnsv add lineto}{pnlh pnlv moveto pnsh 0 rlineto
-0 pnsv rlineto @2 pnsh add @1 pnsv add lineto pnsh neg 0 rlineto
-0 pnsv neg rlineto}ifelse}ifelse
-closepath fill}if @2 @1 grestore moveto}ifelse}bdf
-/gw{/pnm fg 3 get fg 4 get div def}bdf
-/lw{fg exch 4 exch put fg exch 3 exch put gw pnsv pnsh pen}bdf
-/barc{/@1 xdf/@2 xdf/@3 xdf/@4 xdf/@5 xdf
-/@6 xdf/@7 xdf/@8 xdf gsave
-@5 @7 add 2 div @6 @8 add 2 div translate newpath 0 0 moveto
-@5 @7 sub @6 @8 sub mtx currentmatrix pop scale @1{newpath}if
-0 0 0.5 @4 @3 arc @4 @3 sub abs 360 ge{closepath}if
-mtx setmatrix @2 doop grestore}bdf
-/ar{dup 0 eq barc}bdf
-/ov{0 exch 360 exch true barc}bdf
-/rc{/@t xdf currentpoint 6 2 roll newpath 4 copy 4 2 roll exch moveto
-6 -1 roll lineto lineto lineto closepath @t doop moveto}bdf
-/mup{dup pnsh 2 div le exch pnsv 2 div le or}bdf
-/rr{/@1 xdf 2. div/@2 xdf 2. div/@3 xdf
-/@4 xdf/@5 xdf/@6 xdf/@7 xdf
-@7 @5 eq @6 @4 eq @2 mup or or{@7 @6 @5 @4 @1 rc}
-{@4 @6 sub 2. div dup @2 lt{/@2 xdf}{pop}ifelse
-@5 @7 sub 2. div dup @2 lt{/@2 xdf}{pop}ifelse
-@1 0 eq{/@2 @2 pnsh 2 div 2 copy gt{sub def}{0 pop4}ifelse}if
-currentpoint newpath
-@4 @6 add 2. div @7 moveto
-@4 @7 @4 @5 @2 arcto pop4
-@4 @5 @6 @5 @2 arcto pop4
-@6 @5 @6 @7 @2 arcto pop4
-@6 @7 @4 @7 @2 arcto pop4
-closepath @1 doop moveto}ifelse}bdf
-/pr{gsave newpath/pl{exch moveto/pl{exch lineto}def}def}bdf
-/pl{exch lineto}bdf
-/ep{dup 0 eq{{moveto}{exch lin}{}{(%%[|1|]%%)= flush}pathforall
-pop grestore}{doop grestore}ifelse currentpoint newpath moveto}bdf
-/gr{64. div setgray}bdf
-/savescreen{ns not{/ns true def systemdict/currentcolorscreen known{currentcolorscreen/pkspf xdf/pkrot xdf/pkfreq xdf/pyspf xdf/pyrot xdf/pyfreq xdf/pmspf xdf/pmrot xdf/pmfreq xdf
-/pcspf xdf/pcrot xdf/pcfreq xdf}{currentscreen/sspf xdf/srot xdf/sfreq xdf}ifelse}if}bdf
-/restorescreen{/ns false def systemdict/setcolorscreen known{pcfreq pcrot/pcspf load pmfreq pmrot/pmspf load pyfreq pyrot/pyspf load
-pkfreq pkrot/pkspf load setcolorscreen}{sfreq srot/sspf load setscreen}ifelse}bdf
-/pat{savescreen sa8
-copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi sa8 exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}setscreen exch not{gr}{pop}ifelse}bdf
-/sg{restorescreen gr}bdf
-/cpat{savescreen 10 2 roll 7 -1 roll sa8 copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi sa8 exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}8 -1 roll sb8 copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi sb8
-exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}9 -1 roll sc8 copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi sc8 exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}10 -1 roll sd8 copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi sd8
-exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}psuedo1 dsc 4{4 -1 roll 1 exch 64 div sub}repeat setcmykcolor pop pop}bdf
-systemdict/setcolorscreen known{/psuedo1 lnop bdf/dsc/setcolorscreen load def}{/psuedo1{16{pop}repeat sa8 copy pop 9.375 pa por not{90 add}if{1 add 4 mul cvi sa8 exch get exch 1 add 4 mul cvi 7 sub bitshift 1 and}}bdf
-/bwsc{setscreen dup gr 0 exch 0 exch 64 exch 64 exch 64 exch}bdf/dsc/bwsc load def
-}ifelse
-systemdict/setcmykcolor known not{/setcmykcolor{1 sub 4 1 roll 3{3 index add neg dup 0 lt{pop 0}if 3 1 roll}repeat setrgbcolor pop}bdf}if
-/dc{transform round .5 sub exch round .5 sub exch itransform}bdf
-/sn{userdict/smooth4 known}bdf
-/x8{3 bitshift}bdf
-/x4{2 bitshift}bdf
-/d4{-2 bitshift}bdf
-/d8{-3 bitshift}bdf
-/rb{15 add -4 bitshift 1 bitshift}bdf
-/db{/@7 save def/@1 xdf/@2 xdf/@3 xdf/@4 xdf/@5 xdf/@6 @5 @3 4 add mul def
-dc translate scale/xdbit 1 1 idtransform abs/ydbit exch def abs def{0 0 1 ydbit add 1 10 rc clip}if
-@1 0 eq @1 4 eq or{currentrgbcolor 1 setgray ydbit 0 1 ydbit add 1 2 rc setrgbcolor}if
-@1 3 eq @1 7 eq or{1 setgray}{currentrgbcolor 2 index eq exch 2 index eq and exch pop{0 setgray}if}ifelse/@9 @1 0 eq @1 1 eq @1 3 eq or or dbinvertflag xor def/@13 @6 def
-@2 fBitStretch or{/@10 @4 x4 def/@11 @3 x4 def/@12 @10 rb def/@13 @12 @11 mul def/@15 1 1 dtransform abs/calcY 1 index def round cvi/@14 exch def
-abs/calcX 1 index def round cvi scaleby96 not{1 add}if def/@16 @15 rb def/@17 @16 @14 mul def}if
-sn @13 60000 lt and @2 fBitStretch or and{mtx currentmatrix dup 1 get exch 2 get 0. eq exch 0. eq and @17 60000 lt and fBitStretch and{@16 3 bitshift @14 @9 [calcX 0 0 calcY 0 0]{@17 string @13 string
-currentfile @6 string readhexstring pop 1 index @4 @3 @5 @12 @2 smooth4
-@10 @11 @12 dup string 5 index @15 @14 @16 dup string stretch}imagemask}{@12 x8 @11 @9 [@10 0 0 @11 0 0]{@13 string
-currentfile @6 string readhexstring pop 1 index @4 @3 @5 @12 @2 smooth4}imagemask}ifelse}{@5 3 bitshift @3 4 add @9 [@4 0 0 @3 0 2]{currentfile @6 string readhexstring pop}imagemask}ifelse
-@7 restore}bdf
-systemdict/setcmykcolor known{/psuedo lnop bdf/di/colorimage load def}{/routines[{.3 mul add 1}bind{.59 mul add 2}bind{.11 mul add round cvi str exch i exch put/i i 1 add def 0 0}bind]def
-/psuedo{/i 0 def 0 exch 0 exch{exch routines exch get exec}forall pop pop str}bdf/bwi{pop pop image}bdf/di/bwi load def}ifelse
-/cdb{/@7 save def/@1 xdf/@2 xdf/@3 xdf/@4 xdf/@5 xdf
-systemdict/setcmykcolor known not{dc}if translate scale /@6 xdf
-/@18 @5 dup 60000 ge{pop 60000}if string def @6 not{/str @18 0 @18 length 3 idiv getinterval def}if @4 @3 8 [@4 0 0 @3 0 0]@6{{currentfile @18 readhexstring pop}image}{{currentfile @18 readhexstring pop psuedo}false 3 di}ifelse @7 restore}bdf
-/wd 16 dict def
-/mfont 14 dict def
-/mdf{mfont wcheck not{/mfont 14 dict def}if mfont begin xdf end}bdf
-/cf{{1 index/FID ne{def}{pop pop}ifelse}forall}bdf/rf{/@1 exch def/@2 exch def
-FontDirectory @2 known{cleartomark pop}{findfont dup begin dup length @1 add dict begin
-cf{/Encoding macvec def}{Encoding dup length array copy/Encoding exch def
-counttomark 2 idiv{Encoding 3 1 roll put}repeat}ifelse
-pop
-exec currentdict end end @2 exch definefont pop}ifelse}bdf
-/bmbc{exch begin wd begin
-/cr xdf
-save
-CharTable cr 6 mul 6 getinterval{}forall
-/bitheight xdf/bitwidth xdf
-.96 div/width xdf
-Gkernmax add/XOffset xdf Gdescent add/YOffset xdf/rowbytes xdf
-rowbytes 255 eq{0 0 0 0 0 0 setcachedevice}
-{Gnormsize dup scale
-width 0 XOffset YOffset bitwidth XOffset add bitheight YOffset add
-setcachedevice
-rowbytes 0 ne{
-XOffset YOffset translate newpath 0 0 moveto
-bitwidth bitheight scale
-sn{
-/xSmt bitwidth x4 def
-/ySmt bitheight x4 def
-/rSmt xSmt rb def
-rSmt x8 ySmt true
-[xSmt 0 0 ySmt neg 0 ySmt]
-{rSmt ySmt mul string CharData cr get
-1 index bitwidth bitheight rowbytes rSmt tso smooth4}
-}{rowbytes 3 bitshift bitheight 4 add true
-[bitwidth 0 0 bitheight neg 0 bitheight 2 add]
-{CharData cr get}
-}ifelse
-imagemask
-}if
-}ifelse
-restore
-end end
-}bdf
-/bb{.96 exch div/Gnormsize mdf 2 index
-/Gkernmax mdf 1 index/Gdescent mdf
-3 index div 4 1 roll
-2 index div 1. 5 2 roll
-exch div 4 1 roll
-4 array astore/FontBBox mdf
-}bdf
-/cdf{mfont/CharData get 3 1 roll put}bdf
-/bf{
-mfont begin
-/FontType 3 def
-/FontMatrix [1 0 0 1 0 0] def
-/Encoding macvec def
-/MFontType 0 def
-/BuildChar/bmbc load def
-end
-mfont definefont pop
-}bdf
-/wi LW 1 eq{{gsave 0 0 0 0 0 0 0 0 moveto lineto lineto lineto closepath clip stringwidth grestore}bind}{/stringwidth load}ifelse def
-/aps{0 get 124 eq}bdf
-/xc{s75 cvs dup}bdf
-/xp{put cvn}bdf
-/scs{xc 3 67 put dup 0 95 xp}bdf
-/sos{xc 3 79 xp}bdf
-/sbs{xc 1 66 xp}bdf
-/sis{xc 2 73 xp}bdf
-/sob{xc 2 79 xp}bdf
-/sss{xc 4 83 xp}bdf
-/dd{exch 1 index add 3 1 roll add exch}bdf
-/smc{moveto dup show}bdf
-/ndf2{udf{dup /FontType get 0 eq{/FDepVector get{dup /FontType get 0 eq{ndf2}{dup /df2 known{begin df2 0 null put end
-}{pop}ifelse}ifelse}forall}{/df2 known{dup begin df2 0 null put end}if}ifelse}{pop}ifelse}bdf
-/kwn{FontDirectory 1 index known{findfont dup ndf2 exch pop}}bdf
-/gl{1 currentgray sub setgray}bdf
-/newmm{dup /FontType get 0 eq{dup maxlength dict begin{1 index/FID ne 2 index/UniqueID ne and{def}{pop pop}ifelse}forall currentdict end
-dup /FDepVector 2 copy get[exch 6 index exch 6 index exch{newmm 3 1 roll}forall pop pop] put dup
-}{/mfont 10 dict def mfont begin/FontMatrix [1 0 0 1 0 0] def
-/FontType 3 def/Encoding macvec def/df 1 index def/df2 1 array def/FontBBox [0 0 1 1] def/StyleCode 2 index def
-/mbc{bcarray StyleCode get}def/BuildChar{exch begin wd begin/cr exch def/cs s1 dup 0 cr put def df /MFontType known not{
-df2 0 get null eq{df dup length 2 add dict begin{1 index/FID ne 2 index/UniqueID ne and{def}{pop pop}ifelse}forall
-/StrokeWidth nlw 1000 mul pys div ps div dup 12 lt{pop 12}if def/PaintType 2 def currentdict end
-/q exch definefont df2 exch 0 exch put}if}if mbc exec end end}def end mfont}ifelse
-3 index exch definefont exch pop}bdf
-/mb{dup sbs kwn{0 2 index findfont newmm exch pop exch pop exch pop}ifelse sfd}bdf
-/mo{dup sos kwn{2 2 index findfont newmm exch pop exch pop exch pop}ifelse sfd}bdf
-/ms{dup sss kwn{4 2 index findfont newmm exch pop exch pop exch pop}ifelse sfd}bdf
-/ou{dup sos kwn{mfont/df2 known{mfont begin df2 0 null put end}if 3 2 index findfont newmm exch pop exch pop exch pop}ifelse sfd}bdf
-/su{dup sss kwn{mfont/df2 known{mfont begin df2 0 null put end}if 5 2 index findfont newmm exch pop exch pop exch pop}ifelse sfd}bdf
-/ao{/fmv true def ou}bdf/as{/fmv true def su}bdf
-/vo{/fmv false def ou}bdf/vs{/fmv false def su}bdf
-/c{currentrgbcolor dup 4 1 roll eq 3 1 roll eq and/gray xdf}bdf
-/bcarray[{/da .03 def df setfont gsave cs wi 1 index 0 ne{exch da add exch}if grestore setcharwidth
-cs 0 0 smc da 0 smc da da smc 0 da moveto show}bind dup{/da 1 ps div def df setfont gsave cs wi 1 index 0 ne{exch da add exch}if grestore setcharwidth
-cs 0 0 smc da 0 smc da da smc 0 da smc c gray{gl}{1 setgray}ifelse da 2. div dup moveto show}bind
-{df setfont gsave cs wi grestore setcharwidth c gray{gl}{currentrgbcolor 1 setgray}ifelse cs 0 0 smc df2 0 get setfont
-gray{gl}{4 1 roll setrgbcolor}ifelse 0 0 moveto show}bind
-{/da 1 ps div def/ds .05 def/da2 da 2. div def df setfont gsave cs wi 1 index 0 ne{exch ds add da2 add exch}if grestore setcharwidth
-cs ds da2 add .01 add 0 smc 0 ds da2 sub translate 0 0 smc da 0 smc da da smc 0 da smc c gray{gl}{1 setgray}ifelse da 2. div dup moveto show}bind
-{/da .05 def df setfont gsave cs wi 1 index 0 ne{exch da add exch}if grestore setcharwidth c cs da .01 add 0 smc 0 da translate
-gray{gl}{currentrgbcolor 1 setgray 4 -1 roll}ifelse 0 0 smc gray{gl}{4 1 roll setrgbcolor}ifelse df2 0 get setfont 0 0 moveto show}bind]def
-/st{1000 mul usertime add dup 2147483647 gt{2147483647 sub}if def}bdf
-/the{usertime sub dup 0 lt exch -2147483648 gt and}bdf
-/6a 6 array def
-/2a 2 array def
-/3q 3 array def
-/qs{3 -1 roll sub exch 3 -1 roll sub exch}bdf
-/qa{3 -1 roll add exch 3 -1 roll add exch}bdf
-/qm{3 -1 roll 1 index mul 3 1 roll mul}bdf
-/qn{6a exch get mul}bdf
-/qA .166667 def/qB .833333 def/qC .5 def
-/qx{6a astore pop
-qA 0 qn qB 2 qn add qA 1 qn qB 3 qn add
-qB 2 qn qA 4 qn add qB 3 qn qA 5 qn add
-qC 2 qn qC 4 qn add qC 3 qn qC 5 qn add}bdf
-/qp{6 copy 12 -2 roll pop pop}bdf
-/qc{exch qp qx curveto}bdf
-/qi{{exch 4 copy 2a astore aload pop qa .5 qm newpath moveto}{exch 2 copy 6 -2 roll 2 qm qs 4 2 roll}ifelse}bdf
-/qq{{qc 2a aload pop qx curveto}{exch 4 copy qs qa qx curveto}ifelse}bdf
-/pt{currentpoint newpath moveto}bdf
-/qf{/fillflag true def}bdf
-/ec{dup 4 and 0 ne{closepath}if 1 and 0 ne{0 doop}if grestore currentpoint newpath moveto/fillflag false def}bdf
-/eu{currentpoint fp{0 ep}{grestore newpath}ifelse moveto/fillflag false def}bdf
-/bp{currentpoint newpath 2 copy moveto}bdf
-/ef{gsave fillflag{gsave eofill grestore}if}bdf
-/sm{0 exch{@1 eq{1 add}if}forall}bdf
-/lshow{4 1 roll exch/@1 exch def{1 index wi pop sub 1 index sm dv 0 @1 4 -1 roll widthshow}{1 index wi pop sub
-1 index dup sm 10 mul exch length 1 sub add dv dup 10. mul 0 @1 4 -1 roll 0 6 -1 roll awidthshow}ifelse}bdf
-/setTxMode{sa 9 2 index put exch not{3 eq{1}{0}ifelse setgray}{pop}ifelse}bdf
-/SwToSym{{}mark false/Symbol/|______Symbol 0 rf 0 sa 6 get 0 ne{pop 1}{sa 7 get 0 eq{pop 2}if}ifelse
-sa 1 get 0 ne/|______Symbol
-sa 4 get 0 ne{vs}{sa 3 get 0 ne{vo}{fnt}ifelse}ifelse}bdf
-/mc{0 3 1 roll transform neg exch pop}bdf
-/ul{dup 0 ne sa 2 get 0 ne and{gsave 0 0
-/UnderlinePosition kif{mc}{ps -10 div}ifelse/UnderlineThickness kif{mc}{ps 15 div}ifelse
-abs setlinewidth neg rmoveto
-sa 4 get 0 ne{gsave currentlinewidth 2. div dup rmoveto currentpoint newpath moveto
-2 copy rlineto stroke grestore}if
-sa 3 get sa 4 get or 0 ne{gsave currentrgbcolor dup 4 1 roll eq 3 1 roll eq and{gl}{1 setgray}ifelse 2 copy rlineto stroke grestore rlineto strokepath nlw pys div setlinewidth}{rlineto}ifelse
-stroke grestore}{pop}ifelse}bdf
-/sgt{2 copy known{get true}{pop pop false}ifelse}bdf
-/kif{currentfont dup/FontMatrix get exch/FontInfo sgt{true}{currentfont/df sgt
-{dup/FontInfo sgt{3 1 roll/FontMatrix get mtx concatmatrix exch true}{pop pop pop false}
-ifelse}{pop pop false}ifelse}ifelse{3 -1 roll sgt{exch true}{pop false}ifelse}{false}ifelse}bdf
-/blank/Times-Roman findfont/CharStrings get/space get def
-/macvec 256 array def
-/NUL/SOH/STX/ETX/EOT/ENQ/ACK/BEL/BS/HT/LF/VT/FF/CR/SO/SI
-/DLE/DC1/DC2/DC3/DC4/NAK/SYN/ETB/CAN/EM/SUB/ESC/FS/GS/RS/US
-macvec 0 32 getinterval astore pop
-macvec 32/Times-Roman findfont/Encoding get
-32 96 getinterval putinterval macvec dup 39/quotesingle put 96/grave put
-/Adieresis/Aring/Ccedilla/Eacute/Ntilde/Odieresis/Udieresis/aacute
-/agrave/acircumflex/adieresis/atilde/aring/ccedilla/eacute/egrave
-/ecircumflex/edieresis/iacute/igrave/icircumflex/idieresis/ntilde/oacute
-/ograve/ocircumflex/odieresis/otilde/uacute/ugrave/ucircumflex/udieresis
-/dagger/degree/cent/sterling/section/bullet/paragraph/germandbls
-/registered/copyright/trademark/acute/dieresis/notequal/AE/Oslash
-/infinity/plusminus/lessequal/greaterequal/yen/mu/partialdiff/summation
-/product/pi/integral/ordfeminine/ordmasculine/Omega/ae/oslash
-/questiondown/exclamdown/logicalnot/radical/florin/approxequal/Delta/guillemotleft
-/guillemotright/ellipsis/blank/Agrave/Atilde/Otilde/OE/oe
-/endash/emdash/quotedblleft/quotedblright/quoteleft/quoteright/divide/lozenge
-/ydieresis/Ydieresis/fraction/currency/guilsinglleft/guilsinglright/fi/fl
-/daggerdbl/periodcentered/quotesinglbase/quotedblbase/perthousand/Acircumflex/Ecircumflex/Aacute
-/Edieresis/Egrave/Iacute/Icircumflex/Idieresis/Igrave/Oacute/Ocircumflex
-/apple/Ograve/Uacute/Ucircumflex/Ugrave/dotlessi/circumflex/tilde
-/macron/breve/dotaccent/ring/cedilla/hungarumlaut/ogonek/caron
-macvec 128 128 getinterval astore pop
-{}mark true/Courier/|______Courier 0 rf
-{/Metrics 21 dict begin/zero 600 def/one 600 def/two 600 def/three 600 def/four 600 def/five 600 def/six 600 def/seven 600 def/eight 600 def
-/nine 600 def/comma 600 def/period 600 def/dollar 600 def/numbersign 600 def/percent 600 def/plus 600 def/hyphen 600 def/E 600 def/parenleft 600 def/parenright 600 def/space 600 def
-currentdict end def currentdict/UniqueID known{/UniqueID 16#800000 def}if/FontBBox FontBBox 4 array astore def}mark true/Helvetica/|______Seattle 1 rf
-/oldsettransfer/settransfer load def
-/concatprocs{/proc2 exch cvlit def/proc1 exch cvlit def/newproc proc1 length proc2 length add array def
-newproc 0 proc1 putinterval newproc proc1 length proc2 putinterval newproc cvx}def
-/settransfer{currenttransfer concatprocs oldsettransfer}def
-/PaintBlack{{1 exch sub}settransfer gsave newpath clippath 1 setgray fill grestore}def
-/od{(Rvd\001\001\000\000\177) fg copy pop txpose
-1 0 mtx defaultmatrix dtransform exch atan/pa exch def
-newpath clippath mark
-{transform{itransform moveto}}{transform{itransform lineto}}
-{6 -2 roll transform 6 -2 roll transform 6 -2 roll transform
-{itransform 6 2 roll itransform 6 2 roll itransform 6 2 roll curveto}}
-{{closepath}}pathforall newpath counttomark array astore/gc xdf pop ct 39 0 put
-10 fz 0 fs 2 F/|______Courier fnt invertflag{PaintBlack}if
-statusdict/processcolors known{statusdict begin processcolors end dup 4 eq{/4colors true def pop}{3 eq{/3colors true def}{/2color true def}ifelse}ifelse}{/2colors true def}ifelse}bdf
-/cd{}bdf
-/op{/sfl false def systemdict/currentcolorscreen known{dcfreq dcrot/dcspf load dmfreq dmrot/dmspf load dyfreq dyrot/dyspf load
-dkfreq dkrot/dkspf load setcolorscreen}{freq rot/spf load setscreen}ifelse savescreen
-/ns false def/pm save def}bdf
-/cp{not{userdict/#copies 0 put}if ma 0 gt{{t1 the{exit}if}loop}if{copypage}{showpage}ifelse pm restore}bdf
-/px{0 3 1 roll tp tt}bdf
-/psb{/us save def}bdf
-/pse{us restore}bdf
-/ct 40 string def
-/nc{currentpoint initclip newpath gc{dup type dup/arraytype eq exch/packedarraytype eq or{exec}if}
-forall clip newpath moveto}def
-/kp{ct 0 2 index length 2 index 39 2 index put getinterval copy cvx exec mx3 currentmatrix pop}bdf
-/av 70 def
-end
-LW 1 eq userdict/a4small known not and{/a4small
-[[300 72 div 0 0 -300 72 div -120 3381]
-280 3255
-{statusdict/jobstate (printing) put 0 setblink
-margins
-exch 196 add exch 304 add 8 div round cvi frametoroket
-statusdict/jobstate (busy) put
-1 setblink}
-/framedevice load
-60 45{dup mul exch dup mul add 1.0 exch sub}/setscreen load
-{}/settransfer load/initgraphics load/erasepage load]cvx
-statusdict begin bind end readonly def}if
-md begin/bigs[lnop userdict/letter known{/letter load}{lnop}ifelse userdict/legal known{/legal load}{lnop}ifelse userdict/a4 known{/a4 load}{lnop}ifelse userdict/b5 known{/b5 load}{lnop}ifelse
-lnop lnop lnop /tab load/a3Size load]def
-/smalls[lnop userdict/lettersmall known{/lettersmall load}{userdict/note known{/note load}{lnop}ifelse}ifelse
-userdict/legal known{/legal load}{lnop}ifelse userdict/a4small known{/a4small load}{lnop}ifelse
-userdict/b5 known{/b5 load}{userdict/note known{/note load}{lnop}ifelse}ifelse lnop lnop lnop /tab load/a3Size load]def end
-systemdict/currentpacking known{setpacking}if
-/checkload{{currentfile eexec} {/junk save def/mystring 65000 string def
-/endexec (%endeexec) def{currentfile mystring readline not{stop}if endexec eq{exit}if}loop junk restore}ifelse}bind def
-ok userdict/stretch known not and checkload
-373A767D4B7FD94FE5903B7014B1B8D3BED02632C855D56F458B118ACF3AF73FC4EF5E81F5749042B5F9CF1016D093B75F250B7D8280B2EACE05A37037F7BDF6E12226D7D4E2DF2C52FAFD5FD40FE72A0D3AC4BD485D8369D4C87636E920D1DAF222D92155A9CB1667E715F0B82799B37CC8F5B32B74B39CF494536DC39C7EF04A7BCB29E2CEC79073CADCCFB23B4AA1363F876F5121B618071B7B4EB1E5DE75FAA2368A3E5DB2B198623AFE92AE9484270FE7F57A850E88C0D3EEA156611C91D8E480D4370B025CCA6929A2BF40AD3D01B2CB7EE6DFB46E12A830542337F7819B67F9765210F76DB06F34DA5B13A11759305C582E16D2B854939F6D9121F2A4F285282F5DCD3D15896D121E3D6F5BE79E087451BB0ED233CDBEF090D3B4AC2DC34B97E70C61D95FB072B8C12D2ABD843520949A39DCF99E2C1AA8FBCD025E47E0A82A8D96E75BAF40F52AD402495BBD4DE0F356C8B14E764874E639C9F045A0D1908EC6456EB6C5B8A6F826192F767EF2C55A21C58F5F9CC1F59247B55F2387828C7FE89D5E7D8484D1BC86CB6673BDBE4FE17DD9BDE95224FE645136F41330BF155A4DDE1B0A32233BF471CE58FBC660DC7E641B0A0D30018454E2191C414A3011FF3FED1C0D88FE1FF9F75DCC456D097947226FBEC92509146D3A4CFFC0471B31C53222ED9DD88566F60F6C0D705AD79DACF53B070026F083ED28B5CF757AAA0A169F6F320A75E9D2ED50ABD939AF85B6346C2ADB25D168F10508E1516D194C635E6B187FADEA0829DBF0390C0F003F0265E215BC96CA3CC13D4A8E01570BE193CA75A620728CD275ACF1986EFFB3A13419FE55EA7C4467B7E7EEDC1FC29C9F8C46A557D2CCDB914EF7B93E7530D555DFC2398AFC68CAD991F062EF85BAA1884EC166C7C5DF8543666D8C41BE267D706BD1588F1F662F705CAE4D29DC38EF66BFAA89470D8A099B6F1B4587F7B024412276106FCD3EB5AE17A5D1DF1781992DC40EA0A992F706F701304CEA9D9073E7A74F1E687D81C3E5841D31CF86855BAAAD9B5D30317C75150A857C6B114735315CDD1AEF36C26BBB0645499406DEE2F24B3B1C72FEC97C7BA31AA2CDAB25418BB1DC4C7E4757F1D625087B0FD0300C03A65F2A72CE734925735277E034CDCF599129679F70CC8B66E03878851DB75041F275E1E5761F3EC753BE1359CA364A22047AE4886217F9259FE19FF5B116E8019B98B143114B313E8BEF87EC949D85C82E0812E6F50525E73890AF362CC8EE8A85F4197E6AC18638EF12E56A808D439AF1BFD363F140314BF4E534485C42F1856688CC35288E8D770120A420FB9F1FCF8AE8BD6D6156CC23E6C51119FE4DE1B68C9DF3487E9974BF9ED31F8D3CE93FF101867319F2FF492D5D398B4F09A66F2F55BCAB34B99173B7EE89039D00DD21A7B3A52E9F028F8301B5FC12D409412E064513BC579AAC498F577EA8ECD1FE3E42DC3CC320786C7B00194FEDF344402C33FC492D4BA86992B01683F440220FFE756BC88A94223D316078D69D33560E8EAB76B24CB7AA4320CF435593D76F624324ABE00B5587A4F283C725EA24567133F25F472B5E2E4474DDB5A16AC5F2DF32350395D3E3892FE361F4D5C9A610C654C9227614FBBAFF3356A90A2266E00F66234061075491571A65616211257F160000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%endeexec
-
-ok userdict/smooth4 known not and checkload
-F94E00EE41A71C59E5CAEED1EDBCF23D1DBA1EE99B9BB356492923BD8B1BA83A87CEB0E07377A31FD6241E814681118E17DC7CACE570399506E6E441B871B6043831BD03EFC11DBBD8001EE2FF8CFBD485065D455A2E15AC36F1A84AD8789FA6461199C7CD14CB9FD64D4B06452B7FC0A8FC263F70F1CCB893295D4DE70ADAB771C0F84396FA98C60B11DA02ABA157298DF0A23621853BEF167443A985ADC09BEFFD51CB4D29179E2B34609EF38A49DA61F4BFC256A3DE0732D7D29754A194857B9C9E9971227AA1DD0611FBB10E44E5FF66C062D9C24ED3290529330BC317825E876929582DB0E39B9FC5EFD20CC1D4F94920EB9C534D0DA90DE70D25BC7287319CF28602B3F46633C242CAFC8905E960317E3C2FA20AB8DB06ADBAF292FC7BA2CA14EE65DF28B99CC11666B70AD33E8E1D57D63D4B89ECC615AE5747C1CA752C833D8D6DE54CD4A0350B44310555CE3BD2C615ADD27B634CDB350AF3A432CE78AACD2909A5B586F666CD87919A36DB1CBE86B3CE281DFD01CD7E1B8A18A4B415CECBFF79A5C4390A15EA77D14D6BE12BAB5A8268C3F286D0590060647CABED674443CD258F11415E866AB330A251691B61F2422A61AFE59B6B4FBDCF85ED9BA0F8E483C034089E6877FF5923698D3A0DC0EED6B9CFD32DF0839BC4EA5F6D1FCB6DD0920391E57E84745131D02D100179F4E0A68EC0A5FF6680A6F463D038B04AF63FFA13D743B995A26A743C26D387209023C91DE43DF047A16F328AC9DDC08573B38BE9EA341EA16C78EC32F3A1B36B90D95A50610F4D050EC1C33497F3F3A81A1B4C8BEF0BA84EE2FAA32DC112DAC490AF53E1749C4A0D866CAF7B893E52383B0D38065C333FB122B700D7246F7EE87D942AE3DB5C1DD77E9E76C80CC5AD63D28DFED0E229CE604673F78CD47F258FDF5BF3A3EAEC5C9BC8E482D8DBA9D268A35DA8C095A690679ED2123E8B8F5E4826FA3B199EAA5D482D4B6AA86572E387CECEB7149C8947F41D6339328A748A17F8C4AD3B0555F1E409450BA0C564F1F488BB5096EB003568D4D5EF6489897E27409547D0EE4487D30184793B0F27BD265A64BDB3EA6761569DA955620C612E718677B77D6D81B999C6298877AFE0D1D6F6F358377A8BD2402F669C64B972B3A065EF7DD4BDEFFFE17E63DB8898FA6E69166B710AAD6BA2EA9AF61E4B8C8701638D4D6E4DFFFC192AEF6BC027095C4C72D748979675BA29FAF61E75343E14E61034602E5A79CD2519796ED6A9CC4EDEA46A9B59D4A807E786B5EE46F25B0360BC8E7C12D723122CDEEF247C9776F4C99C8EBED6828AA19744B5ADF0D07D95D98B3072372388D41B0FAB1CCE2775170679575ECDCA13B22A17FE9C6605C3445F58F1A829512DAB6C528F83580C8AA53C35D605F626F5AD0B7FC1EA87D69A835E3F53A1F450FB0AF42A5772F89D92A50D10F15BDBDA409F50C0B8AB93FE8A16D029DD8BB5C480D1466735ED4D9CAF637E5ECD6C2ECB6BF3B3EFBEE7AB936D2C568E3009D156B87CACB1FB3A48A70BC91B2EC35CC9147FFB1A524E2B2F2E4E2C1B12F1C1C63768BB95CD62FEC01CBA79B9FA282DD4DF49990F27FF8EE4E2DDE2F0ACD83BC9D4BE0090192C7A799967EC4DC2D63C0835E22D4C4B366D7FDCF3A05A4B53DF780F986EF25C79B665D5C00EFF7F17C0BB6D544F9D83A7FDAC47D9C5683A656011374253C918FF6EA64749DD971B2300DD5320033E01EC591F6318CCE94CE2B81C04322EC52B624E50643B52391CCD2AB56396A2AD8E2D3CA61B80D9D4CC363B2DF7863526958CDF3497E36648406C317E58EC563E7C26149A2A3C643ADFB39A8DD92974C6D2A2A9D7B71CDF3FEBBF32BB02E7B45CF53AAEAD5E963A4AA4AF9A149A08A4EC303D5F2369977E93F54897EEAD31B06C5845D63F49D65F8E5573962241A57CCD717CE6CA8C784A11192943616EA059B51BC38429E18D0121FCBB6FBD5D909B0D89E616C66DEF6A0F165A7030BD911A1B120468329CBB006C8D37720E531CF31E878CB4AAAC137633675C3D546F5162487AB35F470C042BDEB945E0F2532BF92AA6FD53434440221ECD3533A7AA89900CB19EFE2CD872DF8B7969AF0D3B72BF31DC5DD69CA6460966F61AB17CB507964098DBA3AF122EEC3128A9BAFE1034493F372B36BD1351205E9043A67C544402D8BCE24358C8A5CE33867A00794CF7097D59C88279A11EE9C854E7E7AAE881F9828C569D208F5F33375F59E9A3818CFA38AAD0CBFBA32F9F44A8BB79DE4C40E3886457C16DA4A27953AA1E99472E35F2323F0BAA5E37DC28CBA46FEFB73B190016055ADD4D27615D748499A0E1C4B8C7EC339C1C4D95A813A85918A8D01EEB485DDCDCEA6EA3F2C2A9D85C139CD90CCB352634F9AFE836BCAC0C274E352BA2071B5269D5DE4CCDE3FF990CBA974980C7332AE1545A9C60D5D1459D3AE95C1AC065733AF14FADB440A110DD539563B8D850CD0704C52F3F7CCCB53630D776560CBD22D8FF08F5B354487A171AEC15F5F54DE9CAB668BCAC573E788D92762EF63E76087005F4AC2D02E0CAC173C11BE62ACE5DC4D3374F2F9746C9981E125FF9AB8CAE76D13039E2C54DFD708E028A619EA1ED78E6B46F06DF0D0B74BBEDD8C190C7C0CEBDE8F7A4888CC36575313478DD2CFE392E9BB7B2416955D44B7024A3BA43FBF37293B386D64746D7748895411D243FAEC50638F2AA33337D7FA018ADDAC5835A0DDFAE99AD6299DFB4CA6872C59853E3AC12FC9E3D26629C5B49CF844C87B3C4BFBE3074E3A1CE6984758C20C661084381CD6B4582D84F19C0000B5FC0DCB42B567E396031601C095D7016283EBE5F13CD8A3A374A74DDBBABD36081149F8BC242085F2F7297CC97FD3B8BAD206D8AC9707A39ECCC7963B522E08DA391A1EF12DD4D746DBDDDCC0834F88160CF189A9645567CEC2F023A571AF0DFD15DB85B744C28C000DF53B05F8F210841F6E87A04F20C777B7C0BE6182BE2E90226E5301A12532A745F2FAAA81637CF11B78CD2B99A4D18B862D6C5DBD31793FB16A2D9AAD376D4484D75AA833D0068B1D34DB74E3302480854E3B5484D8A47E39A89A2FA927BC3641EA7F8E004FDE4C2F08D40D99F1ACB47CAF6887629BF6DFE12968D297596D28CE0CF148B12E7DCB49FB94F5ADBD214C3A6CE1E249831BA9EB8A189F2CE1ABE39A7B537253E369A508A2AF2ADB9463F9B56BBBFF31D535FF997F537C6675C196E7ECBD493F652FA7CC6D9C1CA3379BFDB5AF7513C6E834054494296B91A6EE800114363D5D5D0759F41B4DECB653B9DE3E94583579EF549ED5F3FAFB12661ABC0C57A332406517ED3454EDED34B386C60F78DC976266E0EAF54FC245FB0E3EFC8016236436B599C1C97A8C5E0AC8F7836161873C71F01ED9CC25C236420F41FD8277993D3959205912FA0927B59E3DAE7377D82079447D6E41EE5AEC0DFFF79AF8F4ED47F17EE708FEA45877860D56F8CBCE65A061E8E1CA4A5FBAF0E13429A7F0ADB6F178FA449F46CC539BBC0107E3A53B1C362A04B20E6D721E7E6E1E4976A11DDC98C7614D22B53DFBB6DAE533AC9BE882021A735C30DAA4A44AED09F49A390E8CFF59BD9C30667AF21B03EC5CEBD5C2C3AA2769E8D714191A48E7DDF50B13D1560E82EFB65FCE601AE9E8C351FBA1DED80B7351314E7F9F9A784BFE3759B7E322A84E7B51F9DC5F5D9C8050CD79B27C0A4B0DD68A3C27A948AD6858E35B960D2DEA838C479CAEA83B1A912174ACB2100E55E7A14892D7A9B3711FF0B20065C1995B49E1F23464A92DD140642E3A7B1973849E64D1A3CF60000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000
-cleartomark
-%endeexec
-%%EndProcSet
-
-%%EOF
-%!PS-Adobe-2.0
-%%Title: GDE2.0_small
-%%Creator: Microsoft Word
-%%CreationDate: Sunday, April 26, 1992
-%%Pages: (atend)
-%%BoundingBox: ? ? ? ?
-%%PageBoundingBox: 30 31 582 761
-%%For: Genome1
-%%IncludeProcSet: "(AppleDict md)" 70 0
-%%EndComments
-%%EndProlog
-%%BeginDocumentSetup
-md begin
-
-T T 0 0 730 552 -31 -30 761 582 100 72 72 1 F F F F T T T T psu
-(Genome1; document: GDE2.0_small)jn
-0 mf
-od
-%%EndDocumentSetup
-%%Page: ? 1
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(1)show
-86 90 gm
-18 fz
-2 F /|______Times-Roman fnt
-0.25192 0. 32 0.02519 0.(Genetic Data Environment)awidthshow
-86 306 gm
-1.00982 0. 32 0.10098 0.(version 2.0)awidthshow
-113 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.19348 0. 32 0.01934 0.(Table of Contents)awidthshow
-125 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-0.87683 0.(Introduction.........................................................................................)ashow
-125 148 gm
-( )show
-125 504 gm
-(2)show
-137 90 gm
--0.00367 0.(What's New for this Release)ashow
-137 228 gm
-1.01469 0.(.....................................................................)ashow
-137 226 gm
-( )show
-137 504 gm
-(2)show
-149 90 gm
--0.10981 0.(System Requirements)ashow
-149 196 gm
-1.01313 0.(.............................................................................)ashow
-149 193 gm
-( )show
-149 504 gm
-(2)show
-161 90 gm
--0.09104 0.(Note to Motif users)ashow
-161 184 gm
-1.01264 0.(................................................................................)ashow
-161 182 gm
-( )show
-161 504 gm
-(2)show
-173 90 gm
--0.15522 0.(Installing the GDE)ashow
-173 180 gm
-1.01248 0.(.................................................................................)ashow
-173 178 gm
-( )show
-173 504 gm
-(3)show
-185 90 gm
--0.08174 0.(Using the GDE)ashow
-185 164 gm
-1.01188 0.(.....................................................................................)ashow
-185 163 gm
-( )show
-185 504 gm
-(3)show
-197 90 gm
--0.21920 0.(Data Types)ashow
-197 144 gm
-1.01121 0.(..........................................................................................)ashow
-197 143 gm
-( )show
-197 504 gm
-(7)show
-209 90 gm
--0.10195 0.(Menu Functions)ashow
-221 126 gm
--0.16563 0.(File menu)ashow
-221 176 gm
-1.01232 0.(..................................................................................)ashow
-221 173 gm
-( )show
-221 504 gm
-(7)show
-233 126 gm
--0.20724 0.(Edit menu)ashow
-233 176 gm
-1.01232 0.(..................................................................................)ashow
-233 174 gm
-( )show
-233 504 gm
-(9)show
-245 126 gm
-7.54577 0. 32 0.75457 0.(DNA/RNA menu..........................................................................)awidthshow
-245 208 gm
-( )show
-245 504 gm
-(9)show
-257 90 gm
--0.11619 0.(External Functions)ashow
-257 180 gm
-1.01248 0.(.................................................................................)ashow
-257 179 gm
-( )show
-257 504 gm
-(10)show
-269 90 gm
--0.06219 0.(Bug reports/extensions)ashow
-269 200 gm
-1.01332 0.(............................................................................)ashow
-269 199 gm
-( )show
-269 504 gm
-(12)show
-281 90 gm
--0.14102 0.(Acknowledgments)ashow
-281 180 gm
-1.01248 0.(.................................................................................)ashow
-281 178 gm
-( )show
-281 504 gm
-(12)show
-293 90 gm
--0.08592 0.(Appendix A, File Formats)ashow
-293 216 gm
-1.01406 0.(........................................................................)ashow
-293 214 gm
-( )show
-293 504 gm
-(13)show
-305 90 gm
--0.06129 0.(Appendix B, Adding Functions)ashow
-305 240 gm
-1.01536 0.(..................................................................)ashow
-305 239 gm
-( )show
-305 504 gm
-(16)show
-317 90 gm
-5.07019 0. 32 0.50701 0.(Appendix C, External functions..................................................................)awidthshow
-317 240 gm
-( )show
-317 504 gm
-(19)show
-F T cp
-%%Page: ? 2
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(2)show
-99 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.16366 0.(Introduction)ashow
-126 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.00480 0.(The Genetic Data Environment is part of a growing set of programs for manipulating and analyzing)ashow
-137 90 gm
--0.02925 0.("genetic" data. It differs in design from other analysis programs in that it is intended to be an expandable and)ashow
-148 90 gm
-0.30548 0. 32 0.03054 0.(customizable system, while still being easy to use.)awidthshow
-170 90 gm
--0.03929 0.(There are a tremendous number of publicly available programs for sequence analysis. Many of these)ashow
-181 90 gm
--0.02575 0.(programs have found their way into commercial packages which incorporate them into integrated, easy to use)ashow
-192 90 gm
-0.00381 0. 32 0.00038 0.(systems. The goal of the GDE is to minimize the amount of effort required to integrate sequence analysis)awidthshow
-203 90 gm
-0.02471 0. 32 0.00247 0.(functions into a common environment. The GDE takes care of the user interface issues, and allows the)awidthshow
-214 90 gm
-0.08422 0. 32 0.00842 0.(programmer to concentrate on the analysis itself. Existing programs can be tied into the GDE in a matter of)awidthshow
-225 90 gm
-0.05676 0. 32 0.00567 0.(hours \(or minutes\) as apposed to days or weeks. Programs may be written in any language, and still)awidthshow
-236 90 gm
--0.01551 0.(seamlessly be incorporated into the GDE.)ashow
-258 90 gm
-0.15960 0. 32 0.01596 0.(These programs are, and will continue to be, available at no charge. It is the hope that this system will)awidthshow
-269 90 gm
--0.00163 0.(grow in functionality as more and more people see the benefits of a modular analysis environment. Users)ashow
-280 90 gm
--0.04074 0.(are encouraged to make modifications to the system, and forward all changes and additions to Steven Smith)ashow
-291 90 gm
--0.07734 0.(at smith@nucleus.harvard.edu.)ashow
-316 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.33660 0. 32 0.03366 0.(What's New for this Release)awidthshow
-339 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.02201 0.(There have been several changes made for this 2.0 release of GDE. The most notable changes involve new)ashow
-350 90 gm
-0.06668 0. 32 0.00666 0.(editing capabilities. For most functions, the user can either select the sequences by their name, or by)awidthshow
-361 90 gm
--0.06840 0.(dragging over sections of the sequence text. See editing for more details. Other added features include a new)ashow
-372 90 gm
--0.07867 0.(checking mode, reduced scale viewing for sequence assembly, improved cut/copy/paste, and many new)ashow
-383 90 gm
-0.08651 0. 32 0.00865 0.(external functions. There is also a new file format, GDE format, which retains more of the all of the)awidthshow
-394 90 gm
-0.05279 0. 32 0.00527 0.(available information about a sequence. This format \(unlike Genbank format in GDE1.0\) will not loose)awidthshow
-405 90 gm
-0.02593 0. 32 0.00259 0.(fields such as group numbers, etc.)awidthshow
-427 90 gm
--0.01397 0.(There is one other change that should be noted. The old "flat" file format has changed. The format now)ashow
-438 90 gm
-(compresses leading gaps by allowing an offset number in parentheses after the name. GDE2.0 will still read)show
-449 90 gm
-0.15045 0. 32 0.01504 0.(old "flat" files, but will write them out in the new format. This might cause difficulties for some external)awidthshow
-460 90 gm
-0.17807 0. 32 0.01780 0.(functions written using this format. Because of the change, it is VERY important to keep the GDE1.0)awidthshow
-471 90 gm
-0.02624 0. 32 0.00262 0.(support programs separate from GDE2.0, as some are now incompatible. The original flatfile format can be)awidthshow
-482 90 gm
--0.10980 0.(duplicated using ReadSeq/FastA format and sed.)ashow
-518 90 gm
-14 fz
-2 F /|______Times-Roman fnt
--0.02626 0.(System Requirements)ashow
-541 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.16036 0. 32 0.01603 0.(GDE 2.0 currently runs on the Sun family of workstations. This includes the Sun3 and Sun4 \(Sparcstation\))awidthshow
-552 90 gm
-0.19104 0. 32 0.01910 0.(systems. It was written in XView, and runs on Suns using OpenWindows 2.0 or MIT's X Windows. It)awidthshow
-563 90 gm
-0.00488 0. 32 0.00048 0.(runs in both monochrome, and color, and can be run remotely on any system capable of running X Windows)awidthshow
-574 90 gm
--0.00602 0.(Release 4. You should have at least 15 meg of free disk space available.)ashow
-596 90 gm
-0.14724 0. 32 0.01472 0.(We are also supporting a DECStation version of GDE. This is running under XView 3.0/X11R5. We)awidthshow
-607 90 gm
-0.02227 0. 32 0.00222 0.(encourage interested people to port the programs to their favorite Unix platform. We hope to support the)awidthshow
-618 90 gm
--0.00794 0.(SGI and Cray line of Supercomputers.)ashow
-643 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.36575 0. 32 0.03657 0.(Note to Motif users)awidthshow
-666 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.08575 0. 32 0.00857 0.(GDE2.0 can be run using different window managers. The most common alternative to olwm is the Motif)awidthshow
-677 90 gm
-0.12878 0. 32 0.01287 0.(window manager \(mwm\). The only problem in using another window manager is that the status line is not)awidthshow
-688 90 gm
--0.04948 0.(displayed. We have added a "Message panel" as an option under "File->Properties" which displays all of the)ashow
-699 90 gm
-0.10406 0. 32 0.01040 0.(information contained on the status line.)awidthshow
-F T cp
-%%Page: ? 3
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(3)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03054 0.(People using other window managers may also prefer using xterm, and xedit as default terminals and file)ashow
-92 90 gm
--0.02236 0.(editors. This can be accomplished by replacing all occurrences of 'shelltool' and 'textedit' with 'xterm -e' and)ashow
-103 90 gm
-0.10833 0. 32 0.01083 0.('xedit' in the $GDE_HELP_DIR/.GDEmenus file.)awidthshow
-128 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.33935 0. 32 0.03393 0.(Installing the GDE)awidthshow
-151 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03640 0.(Instructions for the source code release are included in the README.install file.)ashow
-173 90 gm
--0.00282 0.(The binary installations consist of creating a GDE directory, such as /usr/local/GDE, and un-taring the)ashow
-184 90 gm
-0.15594 0. 32 0.01559 0.(installation tarfile into the directory. If you are installing the GDE for your own use, then you can simply)awidthshow
-195 90 gm
-0.01647 0. 32 0.00164 0.(make a GDE subdirectory. There is no need to be superuser \(root\) to do the installation in your own)awidthshow
-206 90 gm
--0.02723 0.(directory. For example:)ashow
-225 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
-0.69610 0. 32 0.06961 0.(demo% )awidthshow
-1 fs
-{}mark T /Courier-Bold /|______Courier-Bold 0 rf
-2 F /|______Courier-Bold fnt
-1.28005 0. 32 0.12800 0.(mkdir /usr/local/GDE)awidthshow
-233 90 gm
-0 fs
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
-0.79788 0. 32 0.07978 0.(demo% )awidthshow
-1 fs
-{}mark T /Courier-Bold /|______Courier-Bold 0 rf
-2 F /|______Courier-Bold fnt
-1.26770 0. 32 0.12677 0.(cp GDE2.0.tar /usr/local/GDE)awidthshow
-241 90 gm
-0 fs
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
-0.55816 0. 32 0.05581 0.(demo% )awidthshow
-1 fs
-{}mark T /Courier-Bold /|______Courier-Bold 0 rf
-2 F /|______Courier-Bold fnt
-0.97320 0. 32 0.09732 0.(cd /usr/local/GDE)awidthshow
-249 90 gm
-0 fs
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
-0.65994 0. 32 0.06599 0.(demo% )awidthshow
-1 fs
-{}mark T /Courier-Bold /|______Courier-Bold 0 rf
-2 F /|______Courier-Bold fnt
-0.85617 0. 32 0.08561 0.(tar -xf GDE2.0.tar)awidthshow
-271 90 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.00643 0.(After this, each new user will need to add two lines to their .cshrc file so that they can find the gde programs)ashow
-282 90 gm
--0.07226 0.(and files.)ashow
-301 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
-0.50384 0. 32 0.05038 0.(demo% )awidthshow
-1 fs
-{}mark T /Courier-Bold /|______Courier-Bold 0 rf
-2 F /|______Courier-Bold fnt
-0.59280 0. 32 0.05928 0.(cat >> ~/.cshrc)awidthshow
-309 90 gm
-1.39968 0. 32 0.13996 0.(set path = \($path /usr/local/GDE/bin\))awidthshow
-317 90 gm
-2.04071 0. 32 0.20407 0.(setenv GDE_HELP_DIR /usr/local/GDE/help/)awidthshow
-325 90 gm
-0.60202 0.(^D)ashow
-344 90 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.06118 0. 32 0.00611 0.(You may wish to make a copy of the .GDEmenus file from the help directory into your home directory.)awidthshow
-355 90 gm
-0.13107 0. 32 0.01310 0.(This is only necessary if you wish to modify your menus. Copy the demo files from /usr/local/GDE/demo)awidthshow
-366 90 gm
--0.02130 0.(into your local directory, and you are now ready to use the GDE.)ashow
-388 90 gm
--0.05734 0.(FastA and Blast need to have the properly formatted databases installed in the $GDE_HELP_DIR under the)ashow
-399 90 gm
-0.15838 0. 32 0.01583 0.(directories FASTA/PIR, FASTA/GENBANK, BLAST/pir BLAST/genbank. For FASTA, simply copy a)awidthshow
-410 90 gm
--0.01397 0.(version of PIR and Genbank into the proper directory. Alternately, the PIR and GENBANK files can be)ashow
-421 90 gm
-0.08224 0. 32 0.00822 0.(symbolic links to copies of Genbank held elsewhere on your system.)awidthshow
-443 90 gm
-0.01754 0. 32 0.00175 0.(Blast installation involves converting PIR and GENBANK to a temporary FASTA format \(using pir2fasta)awidthshow
-454 90 gm
--0.07652 0.(and gb2fasta\) and then using pressdb for nucleic acid, and setdb for amino acid to reformat the databases again)ashow
-465 90 gm
-0.23468 0. 32 0.02346 0.(into blast format. The .GDEmenus file is currently set up to search with blast using the following)awidthshow
-476 90 gm
-0.01464 0. 32 0.00146 0.(databases: pir, genpept, genupdate, and genbank. If you wish to divide these into subdivisions, then the)awidthshow
-487 90 gm
--0.00154 0.(.GDEmenus file will have to be edited.)ashow
-509 90 gm
-0.18249 0. 32 0.01824 0.(The most up to date release of blast can be obtained via anonymous ftp to ncbi.nlm.nih.gov. The most)awidthshow
-520 90 gm
--0.02844 0.(recent release of FASTA can be obtained via anonymous ftp to uvaarpa.virginia.edu.)ashow
-545 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.21560 0. 32 0.02156 0.(Using the GDE)awidthshow
-568 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.08346 0. 32 0.00834 0.(It is assumed that the user is familiar with the Unix, and OpenWindows/Xwindows environments. It is also)awidthshow
-579 90 gm
--0.04437 0.(assumed that people running standard MIT X-Windows will be using the OpenLook window manager)ashow
-590 90 gm
-0.03479 0. 32 0.00347 0.(\(olwm\). Other window managers work with varied success. If you are not certain as to how your system is)awidthshow
-601 90 gm
-0.06744 0. 32 0.00674 0.(set up, please contact your systems administrator.)awidthshow
-623 90 gm
--0.00114 0.(Once the window system has started, and a terminal window \(xterm, shelltool etc.\) you can start up the GDE)ashow
-634 90 gm
-0.61325 0. 32 0.06132 0.(by typing:)awidthshow
-656 90 gm
-1.45217 0. 32 0.14521 0.(demo% )awidthshow
-1 fs
-{}mark T /Times-Bold /|______Times-Bold 0 rf
-2 F /|______Times-Bold fnt
-1.81137 0. 32 0.18113 0.(gde tRNAs)awidthshow
-678 90 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-2 F /|______Times-Roman fnt
--0.00747 0.(This should load the sample data set tRNAs into GDE, and the following window should appear:)ashow
-F T cp
-%%Page: ? 4
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(4)show
-0 0 gm
-(nc 72 90 269 544 6 rc)kp
-64 gr
-112 136 243 419 1 rc
-0 gr
-T 283 8.72726 136 112 98 778 24 T 1 db
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0000000000000000000
-00003FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0040000000000000000
-0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040040000000000000000
-000FE7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFCFC40000000000000000
-0008000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008000004000000000000000000000000000000000000000000000000000000000000000000000000600000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008003F84000000000000000000000000000000000000000000000000000000000000001E0000000860007C0010000FC000060000000000000100000000000000000000000000000000000000000000000000000000000000040000000000000000
-0078003F040000000000000000000000000000000000000000000000000000000000000033000000180000660030000C00000000000000000003000000000000000000000000000000000000000000000000000000000000003C0000000000000000
-00C0001E0400000000000000000000000000000000000000000000000000000000000000601E1B0F3E63C0631E7CF00C0D8CC66CF0D86CC3C367C00000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0001E040000000000000000000000000000000000000000000000000000000000000060331D99986660633331980C0ECCC66D98EC776663B3000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0000C040000000000000000000000000000000000000000000000000000000000000060331999986600630330180F8CCCC67198CC66666333000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-T 283 8 136 120.69564 98 778 23 T 1 db
-0078003F040000000000000000000000000000000000000000000000000000000000000033000000180000660030000C00000000000000000003000000000000000000000000000000000000000000000000000000000000003C0000000000000000
-00C0001E0400000000000000000000000000000000000000000000000000000000000000601E1B0F3E63C0631E7CF00C0D8CC66CF0D86CC3C367C00000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0001E040000000000000000000000000000000000000000000000000000000000000060331D99986660633331980C0ECCC66D98EC776663B3000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0000C040000000000000000000000000000000000000000000000000000000000000060331999986600630330180F8CCCC67198CC66666333000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0000C0400000000000000000000000000000000000000000000000000000000000000633F199F986600631F30F80C0CC6866198CC6667E333000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000040000000000000000000000000000000000000000000000000000000000000063301998186600633331980C0CC6866198CC66660333000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000040000000000000000000000000000000000000000000000000000000000000033311998986620663331980C0CC3066198CC66662333000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0000004000000000000000000000000000000000000000000000000000000000000001F1E198F0E63C07C1D9CEC0FCCC30660F0CC6663C331C00000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C001FFF80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000008C0000000000000000
-00C3FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000110000001000000002200000080000000000004000000000020000000000000200000010000000000000000000400000000000040000000200000000000400000800000000000000000000000000000000000000000C0000000000000000
-00C0000F110000000800003E022200000400001F0421804F0843000001000003C00020020000000800003E004000000000200000F800400400000004F8007800000200000400000000000000000000000000000000000000000C0000000000000000
-00C0000801000000080000200202000004000010862180888C430000010000022000200000000008000020004000000000200000840040040000000480008400000200000400000000000000000000000000000000000000000C0000000000000000
-00C00008111C01FC040000201E2780FE02000010462240888C44803F80800002258C79C22C01FC0400002044F59C3807F01000008238F385870E380880890070B0E100FE0200000000000000000000000000000000000000000C0000000000000000
-T 283 8 136 128.72726 98 778 22 T 1 db
-00C00000110000001000000002200000080000000000004000000000020000000000000200000010000000000000000000400000000000040000000200000000000400000800000000000000000000000000000000000000000C0000000000000000
-00C0000F110000000800003E022200000400001F0421804F0843000001000003C00020020000000800003E004000000000200000F800400400000004F8007800000200000400000000000000000000000000000000000000000C0000000000000000
-00C0000801000000080000200202000004000010862180888C430000010000022000200000000008000020004000000000200000840040040000000480008400000200000400000000000000000000000000000000000000000C0000000000000000
-00C00008111C01FC040000201E2780FE02000010462240888C44803F80800002258C79C22C01FC0400002044F59C3807F01000008238F385870E380880890070B0E100FE0200000000000000000000000000000000000000000C0000000000000000
-00C00008112201F804000020222200FC02000010452241088A44803F00800002261222223201F8040000204446224007E0100000824444464890440880890088C91100FC0200000000000000000000000000000000000000000C0000000000000000
-00C0000F112200F00400003C222200780200001045A2410F0B44801E00800002242122222200F00400003C2844024003C01000008204404440904408F0890088891100780200000000000000000000000000000000000000000C0000000000000000
-00C00008113E00F004000020222200780200001044A7E109094FC01E00800003C42123E22200F00400002010441E3003C0100000823C43C4478C7C08808904F889F100780200000000000000000000000000000000000000000C0000000000000000
-00C00008112000600400002022220030020000104464220888C8400C008000020421220222006004000020284422080180100000824444444882400880890480890100300200000000000000000000000000000000000000000C0000000000000000
-00C00008112200600400002026220030020000108464220888C8400C008000020412222222006004000020444422080180100000844444444882440480988488891200300200000000000000000000000000000000000000000C0000000000000000
-00C00008111C00000400003E1A2180000200001F042424088848400000800002040C19C22200000400003E44341D700000100000F83A33A7875C3804F8687C7088E200000200000000000000000000000000000000000000000C0000000000000000
-00C00000000000000800000000000000040000000000040000000000010000000000000000000008000000000000000000200000000000000000000200000000000400000400000000000000000000000000000000000000000C0000000000000000
-00C00000000000000800000000000000040000000000000000000000010000000000000000000008000000000000000000200000000000000000000000000000000000000400000000000000000000000000000000000000000C0000000000000000
-00C00000000000001000000000000000080000000000000000000000020000000000000000000010000000000000000000400000000000000000000000000000000000000800000000000000000000000000000000000000000C0000000000000000
-00C00800000000002000100000000000100008000000000000000000040002000000000000000020001000000000000000800040000000000000000000000000000000001000000000000000000000000000000000000000000C0000000000000000
-00C0060000000000C0000C00000000006000060000000000000000001800018000000000000000C0000C00000000000003000030000000000000000000000000000000006000000000000000000000000000000000000000000C0000000000000000
-00C001FFFFFFFFFF000003FFFFFFFFFF800001FFFFFFFFFFFFFFFFFFE000007FFFFFFFFFFFFFFF000003FFFFFFFFFFFFFC00000FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-T 283 8 136 136.69564 98 778 23 T 1 db
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC00040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003FE0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003FE0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C4031C0C08F8000000000000000000000000003E23870E1C3877F1C3860E1C3070E1DFC70EFE3070EFE3877F1C3870E1DFC70CFE3060E1C3870C183867F1C3BF8E1C3BFFF1C3060CFE3870E1C3870E1C3870E183070C7FFC0C0000000000000000
-00C40312121808000000000000000000000000003DA489122448908244861224309122420912103091210489082448912242090C1030612244890C184860824484122448408243060C104891224489122448912183091400000C0000000000000000
-00C40491212808000000000000000000000000003BE8102040810084080920404902040210201049020108100840810204021012104892040810122480908408042040804084048912108102040810204081020244902400000C0000000000000000
-00C40491214810000000000000000000000000003BE8102040810084080920404902040210201049020108100840810204021012104892040810122480908408042040804084048912108102040810204081020244902400000C0000000000000000
-00C40491218820000000000000000000000000003BE8102040810084080920404902040210201049020108100840810204021012104892040810122480908408042040804084048912108102040810204081020244902400040C0000000000000000
-00C40FD121FC20000000000000000000000000003BE8902244891084489FA240FD120402112210FD12010811084089122402103F10FDFA0408113F7E89F884088420448840840FDFBF1081022448102040811207EFD02400040C0000000000000000
-00C40851210840000000000000000000000000003BE89022448910844890A240851204021122108512010811084089122402102110850A0408112142890884088420448840840850A1108102244810204081120428502400040C0000000000000000
-00C40852120840000000000000000000000000003DE48812244890824490922084910202091210849101040908204891220208211085090204092142490882048410244840820850A1104081224408102040910428481400040C0000000000000000
-00C4085C0C0840000000000000000000000000003E23870E1C387081C3908E1C8470E1C2070E108470E10387081C3870E1C20721108508E1C3872142390881C3840E1C384081C850A1103870E1C3870E1C3870E428470C03040C0000000000000000
-00C40000000000000000000000000000000000003FE0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000407840C0000000000000000
-00C40000000000000000000000000000000000003FE000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040FC40C0000000000000000
-00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000
-00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000
-00C403882242000000000000000000000000000031C3870E1C3067F183877F1C3077FFE3877F183860E1C3070E183877FFE3870E183070EFE3870E1C3BF8E1C3870C1DFFF8E1C3077F1DFC70EFFFFF8E1C3870EFE3870C00040C0000000000000000
-00C40488224200000000000000000000000000003244891224306081848908243090810489081848612243091218489081048912183091210489122448412244890C24204122430908242091210204122448912104890C00040C0000000000000000
-T 283 8 136 144.72726 98 778 22 T 1 db
-00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000
-00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000041FE40C0000000000000000
-00C403882242000000000000000000000000000031C3870E1C3067F183877F1C3077FFE3877F183860E1C3070E183877FFE3870E183070EFE3870E1C3BF8E1C3870C1DFFF8E1C3077F1DFC70EFFFFF8E1C3870EFE3870C00040C0000000000000000
-00C40488224200000000000000000000000000003244891224306081848908243090810489081848612243091218489081048912183091210489122448412244890C24204122430908242091210204122448912104890C00040C0000000000000000
-00C40808225A00000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101400040C0000000000000000
-00C40808145A00000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101400040C0000000000000000
-00C40808145A00000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101400040C0000000000000000
-00C40888082400000000000000000000000000003448112244FDF887E8900840FD10810891087E89FA240FD0227E8100810890207EFD12210811224488420448113F442042044FD108402102210204204081120108103C00040C0000000000000000
-00C408880824000000000000000000000000000034481122448508842890084085108108910842890A2408502242810081089020428512210811224488420448112144204204485108402102210204204081120108102400040C0000000000000000
-00C40488082400000000000000000000000000003244091224850884248808208490810489084249092208481242408081048810428491210409122448410244092124204102484908202081210204102040910104082400040C0000000000000000
-00C4038F0824000000000000000000000000000031C3870E1C8508842387081C847081038708423908E1C8470E4238708103870E428470E103870E1C3840E1C387211C2040E1C847081C2070E102040E1C3870E103872400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C41FC70E18780000000000000000000000000031833FFF1C3870E1C3877FFE3060E183060E1C3877FFE33F8EFE3070E1C3867FFE3BF8C1833F8E1C3BF8EFE3077F1C3870EFFFC70E183BF8E1C3870C183870E1C3877C00040C0000000000000000
-00C40209121880000000000000000000000000003183040824489122448908103061218306122448908103041210309122448608104840C183041224484121030908244891210209121848412244890C1848912244890C00040C0000000000000000
-00C40210202480000000000000000000000000003244840840810204081008104892024489204081008104842010490204080908108041224484204080420104900840810201021020248042040810122481020408100C00040C0000000000000000
-00C402102024C0000000000000000000000000003244840840810204081008104892024489204081008104842010490204080908108041224484204080420104900840810201021020248042040810122481020408100C00040C0000000000000000
-00C40210202470000000000000000000000000003244840840810204081008104892024489204081008104842010490204080908108041224484204080420104900840810201021020248042040810122481020408100C00040C0000000000000000
-00C40211207E180000000000000000000000000037EFC4084089120448110810FDFA07EFDFA2408910810FC42210FD1204489F88108043F7EFC420408842010FD108408112210210227E80420408913F7E81120448100C00040C0000000000000000
-00C4021120420800000000000000000000000000342844084089120448110810850A042850A24089108108442210851204489088108042142844204088420108510840811221021022428042040891214281120448100C00040C0000000000000000
-00C40209104208000000000000000000000000003428440820489102440908108509042850922048908108441210849102449088104042142844102048410108490820409121020812424041020489214240910244080C7FFC0C0000000000000000
-00C402070E42F000000000000000000000000000342844081C3870E1C38708108508E428508E1C38708108440E108470E1C390881038421428440E1C3840E10847081C3870E102070E423840E1C38721423870E1C3870C00040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-T 283 8 136 152.69564 98 778 23 T 1 db
-00C40209104208000000000000000000000000003428440820489102440908108509042850922048908108441210849102449088104042142844102048410108490820409121020812424041020489214240910244080C7FFC0C0000000000000000
-00C402070E42F000000000000000000000000000342844081C3870E1C38708108508E428508E1C38708108440E108470E1C390881038421428440E1C3840E10847081C3870E102070E423840E1C38721423870E1C3870C00040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C41FC71E18780000000000000000000000000031833FFF1C3870E1C3870CFE3070EFE3860EFE3870EFE3070C1C3860E1C3870CFFFC77F183067F1C3870E1DFC77F1C3BFFF1C3BFFF1C3867FFE3870E183BF8E1C3870C1FE40C0000000000000000
-00C4020910188000000000000000000000000000318304082448912244890C103091210486121048912103090C2448612244890C10209081830608244891224209082448408244840824486081048912184841224489141FE40C0000000000000000
-00C4021010248000000000000000000000000000324484084081020408101210490201080920108102010490124080920408101210210082448908408102040210084080408408040840809081081020248042040810240FC40C0000000000000000
-00C402101024C0000000000000000000000000003244840840810204081012104902010809201081020104901240809204081012102100824489084081020402100840804084080408408090810810202480420408102407840C0000000000000000
-00C402101E2470000000000000000000000000003244840840810204081012104902010809201081020104901240809204081012102100824489084081020402100840804084080408408090810810202480420408102403040C0000000000000000
-00C40211107E180000000000000000000000000037EFC4084089020408913F10FD1201081FA2108112210FD13F4481FA2448913F10210087EFDF8840810204421108408040844884084089F8810810227E88420408912400040C0000000000000000
-00C40211104208000000000000000000000000003428440840890204089121108512010810A21081122108512144810A24489121102100842850884081020442110840804084488408408908810810224288420408912400040C0000000000000000
-00C40209104208000000000000000000000000003428440820488102048921108491010410921040912108492124410922448921102080842850882040810242090820404082448408204908810408124248410204891400040C0000000000000000
-00C402071042F000000000000000000000000000342844081C3870E1C38721108470E103908E103870E10847211C3908E1C38721102070842850881C3870E1C207081C384081C384081C39088103870E423840E1C3870C00040C0000000000000000
-00C4000000000000000000000000000000000000300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000047FFC0C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000
-00C41FDE0C10300000000000000000000000000031C3870E1C3867F183877F1C3070EFE3870E183860E1C3870EFE3877FFFFC70E183870E183870C1C3BF8EFE3870E1DFFF8E1C33F8E1C3870E1C3870EFE3870E183870C03800C0000000000000000
-00C402110C30300000000000000000000000000032448912244860818489082430912104891218486122448912104890810209121848912184890C2448412104891224204122430412244891224489121048912184890C03800C0000000000000000
-00C40211125048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000
-00C40211121048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000
-00C4021E121048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000
-00C402123F10FC00000000000000000000000000344891224481F887E8900840FD12010891227E89FA24089020108900810211207E811207E8913F44884201089022442042044FC4204081120448112010810207E8103C03800C0000000000000000
-00C402112110840000000000000000000000000034489122448108842890084085120108912242890A2408902010890081021120428112042891214488420108902244204204484420408112044811201081020428102403800C0000000000000000
-00C40211211084000000000000000000000000003244891224410884248808208491010489124249092204881010488081020910424091042489212448410104881224204102484410204091024409101040810424082403800C0000000000000000
-T 283 8 136 160.72726 98 778 22 T 1 db
-00C4021E121048000000000000000000000000003408102040809082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102040810201081020248101403800C0000000000000000
-00C402123F10FC00000000000000000000000000344891224481F887E8900840FD12010891227E89FA24089020108900810211207E811207E8913F44884201089022442042044FC4204081120448112010810207E8103C03800C0000000000000000
-00C402112110840000000000000000000000000034489122448108842890084085120108912242890A2408902010890081021120428112042891214488420108902244204204484420408112044811201081020428102403800C0000000000000000
-00C40211211084000000000000000000000000003244891224410884248808208491010489124249092204881010488081020910424091042489212448410104881224204102484410204091024409101040810424082403800C0000000000000000
-00C402112110840000000000000000000000000031C3870E1C3908842387081C8470E103870E423908E1C3870E1038708102070E423870E42387211C3840E103870E1C2040E1C8440E1C3870E1C3870E103870E423872403800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000403800C0000000000000000
-00C41FDE0C10F00000000000000000000000000031C3870E1DFC67F183877F1C3070EFE3870E183860E1C3870EFE3877FFFFC70E183870E183870C1C3BF8EFE3870E1DFFF8E1C33F8E1C3870E19FC60E1DFC70E183870C03800C0000000000000000
-00C402110C30880000000000000000000000000032448912242060818489082430912104891218486122448912104890810209121848912184890C2448412104891224204122430412244891218206122420912184890C03800C0000000000000000
-00C40211125088000000000000000000000000003408102040209082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102024209204021020248101403800C0000000000000000
-00C40211121088000000000000000000000000003408102040209082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102024209204021020248101403800C0000000000000000
-00C4021E1210F0000000000000000000000000003408102040209082481008404902010810202480920408102010810081021020248102024810124080420108102040204204048420408102024209204021020248101403800C0000000000000000
-00C402123F108800000000000000000000000000344891224021F887E8900840FD12010891227E89FA24089020108900810211207E811207E8913F44884201089022442042044FC42040811207E21FA240210207E8103C03800C0000000000000000
-00C402112110880000000000000000000000000034489122402108842890084085120108912242890A2408902010890081021120428112042891214488420108902244204204484420408112042210A24021020428102403800C0000000000000000
-00C40211211088000000000000000000000000003244891220210884248808208491010489124249092204881010488081020910424091042489212448410104881224204102484410204091042210922020810424082403800C0000000000000000
-00C402112110F00000000000000000000000000031C3870E1C2108842387081C8470E103870E423908E1C3870E1038708102070E423870E42387211C3840E103870E1C2040E1C8440E1C3870E422108E1C2070E423872401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C41FDE0E00000000000000000000000000000031C3870E1C3BFFF183070C183070E1C3BFFF19FC77F183870E1C33FFF1C3860C19FC70E1DFC77F183BF8E1C3877FFE3870C1DFC70E1C3860C1C3870E1C3BF8E1C3000402800C0000000000000000
-00C4021112000000000000000000000000000000324489122448408183090C18309122448408182090818489122430408244860C1820912242090818484122448908104890C2420912244860C24489122448412243000401000C0000000000000000
-00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800402800C0000000000000000
-00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800401000C0000000000000000
-T 283 9 136 168.78259 98 778 23 T 1 db
-00C41FDE0E00000000000000000000000000000031C3870E1C3BFFF183070C183070E1C3BFFF19FC77F183870E1C33FFF1C3860C19FC70E1DFC77F183BF8E1C3877FFE3870C1DFC70E1C3860C1C3870E1C3BF8E1C3000402800C0000000000000000
-00C4021112000000000000000000000000000000324489122448408183090C18309122448408182090818489122430408244860C1820912242090818484122448908104890C2420912244860C24489122448412243000401000C0000000000000000
-00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800402800C0000000000000000
-00C40211200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800401000C0000000000000000
-00C4021E200000000000000000000000000000003408102040804082449012244902040804082421008248102040484084080912242102040210082480420408100810810124021020408091240810204080420404800402800C0000000000000000
-00C40212200000000000000000000000000000003448902240884087EFD03F7EFD12044884087E211087E8902244FC4084481FBF7E2102044210087E884204089108108113F40210204489FBF4089022408042040FC00401000C0000000000000000
-00C402112000000000000000000000000000000034489022408840842850214285120448840842211084289022448440844810A142210204421008428842040891081081121402102044890A140890224080420408400402800C0000000000000000
-00C402111000000000000000000000000000000032448812204840842848214284910244840842209084248812248440824410A142208102420808424841020489081040921202081024490A120488122040410208400401000C0000000000000000
-00C402110E00000000000000000000000000000031C3870E1C384084284721428470E1C384084220708423870E1C844081C390A1422070E1C20708423840E1C3870810387211C2070E1C390A11C3870E1C3840E1C8400402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C41FDE3810000000000000000000000000000031C3860E1C3877F183BFFF1C3077F1C3877FFE3070C19FC60E1DFC70E1DFC77F1C3070E1C3070E1C3877F1C3870E1C3BFFF1C3860EFE3870E1DFC70E1DFFF8E1C3870C01000C0000000000000000
-00C4021124300000000000000000000000000000324486122448908184840824309082448908103090C182061224209122420908243091224309122448908244891224484082448612104891224209122420412244891402800C0000000000000000
-00C40211225000000000000000000000000000003408092040810082480408404900840810081049012242092040210204021008404902040490204081008408102040804084080920108102040210204020420408102401000C0000000000000000
-00C40211221000000000000000000000000000003408092040810082480408404900840810081049012242092040210204021008404902040490204081008408102040804084080920108102040210204020420408102402800C0000000000000000
-00C4021E221000000000000000000000000000003408092040810082480408404900840810081049012242092040210204021008404902040490204081008408102040804084080920108102040210204020420408102401000C0000000000000000
-00C402122210000000000000000000000000000034489FA240891087E8840840FD108408910810FD13F7E21FA04021120402110840FD02240FD1224489108408902244884084089FA2108102044210204420420408902402800C0000000000000000
-00C4021122100000000000000000000000000000344890A24089108428840840851084089108108512142210A0402112040211084085022408512244891084089022448840840890A2108102044210204420420408902401000C0000000000000000
-00C40211241000000000000000000000000000003244909220489084248408208490820489081084921422109020209102020908208481220849122448908204881224484082049092104081024208102420410204881402800C0000000000000000
-00C402113810000000000000000000000000000031C3908E1C3870842384081C847081C387081084721422108E1C2070E1C207081C8470E1C8470E1C387081C3870E1C384081C3908E103870E1C2070E1C2040E1C3870C01000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C41FDE3E10000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3870E1C3860E1C3870C02800C0000000000000000
-T 283 8 136 177.72726 98 778 22 T 1 db
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C41FDE3E10000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3870E1C3860E1C3870C02800C0000000000000000
-00C40211203000000000000000000000000000003242091224484082448412103090C24489122430912184861224489122420408243091224489121030612184891224204122430608244891210489122448612244890C01000C0000000000000000
-00C40211205000000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010810204080920408101402800C0000000000000000
-00C40211201000000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010810204080920408101401000C0000000000000000
-00C4021E3C1000000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010810204080920408101402800C0000000000000000
-00C4021220100000000000000000000000000000344210204080408408842010FD13F448902040FD1227E81FA04089020402040840FD022448112210FDFA07E89122442042044FDF88408102010891224489FA0448103C01000C0000000000000000
-00C4021120100000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108912244890A0448102402800C0000000000000000
-00C40211201000000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010489122449090244082401000C0000000000000000
-00C402113E10000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E103870E1C3908E1C3872402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C41FDE3E38000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3070E1C3860E1C3870C01000C0000000000000000
-00C40211204400000000000000000000000000003242091224484082448412103090C24489122430912184861224489122420408243091224489121030612184891224204122430608244891210309122448612244890C02800C0000000000000000
-00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101401000C0000000000000000
-00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101402800C0000000000000000
-00C4021E3C0800000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101401000C0000000000000000
-00C4021220100000000000000000000000000000344210204080408408842010FD13F448902040FD1227E81FA04089020402040840FD022448112210FDFA07E89122442042044FDF88408102010FD1224489FA0448103C02800C0000000000000000
-00C4021120200000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108512244890A0448102401000C0000000000000000
-00C40211204000000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010849122449090244082402800C0000000000000000
-00C402113E7C000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E108470E1C3908E1C3872401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-T 283 8 136 185.69564 98 778 23 T 1 db
-00C4021120200000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108512244890A0448102401000C0000000000000000
-00C40211204000000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010849122449090244082402800C0000000000000000
-00C402113E7C000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E108470E1C3908E1C3872401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C41FDE3E38000000000000000000000000000031DFC70E1C3BFFF1C3BF8EFE3070C1C3870E1C3070E183860E1C3870E1DFFFFF1C3070E1C3870EFE3060E183870E1DFFF8E1C3067F1C3870EFE3070E1C3860E1C3870C02800C0000000000000000
-00C40211204400000000000000000000000000003242091224484082448412103090C24489122430912184861224489122420408243091224489121030612184891224204122430608244891210309122448612244890C01000C0000000000000000
-00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101402800C0000000000000000
-00C40211200400000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101401000C0000000000000000
-00C4021E3C1800000000000000000000000000003402102040804084080420104901240810204049020248092040810204020408404902040810201048920248102040204204048908408102010490204080920408101402800C0000000000000000
-00C4021220040000000000000000000000000000344210204080408408842010FD13F448902040FD1227E81FA04089020402040840FD022448112210FDFA07E89122442042044FDF88408102010FD1224489FA0448103C01000C0000000000000000
-00C4021120040000000000000000000000000000344210204080408408842010851214489020408512242810A0408902040204084085022448112210850A04289122442042044850884081020108512244890A0448102402800C0000000000000000
-00C40211204400000000000000000000000000003242081020404082048410108492124488102084912424109020488102020408208481224409121085090424891224204102485088204081010849122449090244082401000C0000000000000000
-00C402113E38000000000000000000000000000031C2070E1C384081C3840E10847211C3870E1C8470E423908E1C3870E1C204081C8470E1C3870E108508E423870E1C2040E1C850881C3870E108470E1C3908E1C3872402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C41FDE1E00000000000000000000000000000031C3870E1C3867F183877F1C3077F1C3877F183860E1C3070E1C3867FFE3860C1833F8E1C3870EFE3BF8E1DFFF8E1DFFF8E1C33FFF1C3870C1DFC70E1C3870E183870C01000C0000000000000000
-00C4021110000000000000000000000000000000324489122448608184890824309082448908184861224309122448608104860C183041224489121048412242041224204122430408244890C24209122448912184890C02800C0000000000000000
-00C40211100000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101401000C0000000000000000
-00C40211100000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101402800C0000000000000000
-00C4021E1E0000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101401000C0000000000000000
-00C4021210000000000000000000000000000000344810204489F887E8900840FD10840891087E89FA240FD1224489F881089FBF7EFC420408102210884204020422442042044FC408408113F442102044891207E8103C02800C0000000000000000
-00C402111000000000000000000000000000000034481020448908842890084085108408910842890A24085122448908810890A1428442040810221088420402042244204204484408408112144210204489120428102401000C0000000000000000
-T 283 8 136 193.72726 98 778 22 T 1 db
-00C40211100000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101402800C0000000000000000
-00C4021E1E0000000000000000000000000000003408102040809082481008404900840810082480920404902040809081080912244842040810201080420402042040204204048408408101240210204081020248101401000C0000000000000000
-00C4021210000000000000000000000000000000344810204489F887E8900840FD10840891087E89FA240FD1224489F881089FBF7EFC420408102210884204020422442042044FC408408113F442102044891207E8103C02800C0000000000000000
-00C402111000000000000000000000000000000034481020448908842890084085108408910842890A24085122448908810890A1428442040810221088420402042244204204484408408112144210204489120428102401000C0000000000000000
-00C402111000000000000000000000000000000032440810244908842488082084908204890842490922084912244908810490A1428441020408121048410202041224204102484408204092124208102448910424082402800C0000000000000000
-00C402111000000000000000000000000000000031C3870E1C3908842387081C847081C38708423908E1C8470E1C3908810390A1428440E1C3870E103840E1C2040E1C2040E1C844081C387211C2070E1C3870E423872401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C41FDE0E10000000000000000000000000000031C3870E1C3877F183BFFF1C3067F1C3BF8C1C3060E1C3070C1C3BFFF1C3870C183877F1DFC67F183870C1C3877FFE3870CFFFC70E1DFFF8E1C3870E1C3BF8E1C3000402800C0000000000000000
-00C402111230000000000000000000000000000032448912244890818484082430608244840C2430612243090C2448408244890C18489082420608184890C2448908104890C1020912242041224489122448412243000401000C0000000000000000
-00C40211205000000000000000000000000000003408102040810082480408404890840804124048920404901240804084081012248100840209082481012408100810810121021020402042040810204080420404800402800C0000000000000000
-00C40211201000000000000000000000000000003408102040810082480408404890840804124048920404901240804084081012248100840209082481012408100810810121021020402042040810204080420404800401000C0000000000000000
-00C4021E201000000000000000000000000000003408102040810082480408404890840804124048920404901240804084081012248100840209082481012408100810810121021020402042040810204080420404800402800C0000000000000000
-00C40212221000000000000000000000000000003448112244811087E8840840FDF88448843F44FDFA044FD13F4480408408103F7E890084021F887E8113F4489108108113F102102040204204481020448042040FC00401000C0000000000000000
-00C402112210000000000000000000000000000034481122448110842884084085088448842144850A0448512144804084081021428900840210884281121448910810811211021020402042044810204480420408400402800C0000000000000000
-00C40211121000000000000000000000000000003244091224409084248408208508824484212485090248492124404082040821424880820210884240921244890810409211020810202041024408102440410208400401000C0000000000000000
-00C402110E10000000000000000000000000000031C3870E1C3870842384081C850881C384211C8508E1C847211C384081C3872142387081C2108842387211C387081038721102070E1C2040E1C3870E1C3840E1C8400402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C41FDE0E38000000000000000000000000000031C3870E1C3867F1C3BF8CFE3067F1C3877F19FFF8C1C3BF8E183870EFFFC70E183070EFE3867F1C33F8E1C3870EFFFC70E19FFF8E1C3870EFE3870E1C3877F1C3860401000C0000000000000000
-00C4021112440000000000000000000000000000324489122448608244840C10306082448908182040C244841218489121020912183091210486082430412244891210209121820412244891210489122448908244860402800C0000000000000000
-00C40211200400000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090401000C0000000000000000
-T 283 9 136 201.78259 98 778 23 T 1 db
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C41FDE0E38000000000000000000000000000031C3870E1C3867F1C3BF8CFE3067F1C3877F19FFF8C1C3BF8E183870EFFFC70E183070EFE3867F1C33F8E1C3870EFFFC70E19FFF8E1C3870EFE3870E1C3877F1C3860401000C0000000000000000
-00C4021112440000000000000000000000000000324489122448608244840C10306082448908182040C244841218489121020912183091210486082430412244891210209121820412244891210489122448908244860402800C0000000000000000
-00C40211200400000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090401000C0000000000000000
-00C40211200400000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090402800C0000000000000000
-00C4021E200800000000000000000000000000003408102040809084080412104890840810082420412408042024810201021020244902010809084048420408102010210202420420408102010810204081008408090401000C0000000000000000
-00C4021222100000000000000000000000000000344811224481F88408843F10FDF8844890087E2043F40804207E8902010210207EFD1201089F8844FC422408912210210227E204204081120108902040890084081F8402800C0000000000000000
-00C40211222000000000000000000000000000003448112244810884088421108508844890084220421408042042890201021020428512010890884484422408912210210224220420408112010890204089008408108401000C0000000000000000
-00C40211124000000000000000000000000000003244091224410882048421108508824488084220421204041042488101020810428491010490882484412204891210208124220410204091010488102048808204108402800C0000000000000000
-00C402110E7C000000000000000000000000000031C3870E1C390881C3842110850881C3870842204211C3840E423870E102070E428470E10390881C8440E1C3870E102070E422040E1C3870E103870E1C387081C3908401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C41FDE0E38000000000000000000000000000031C3870E1C3067F183877F1C3077FFE3877F183860E1C3070E183877FFE3870E183070EFE3870E1C3BF8E1C3870C1DFFF8E1C3077F1DFC70EFFFFF8E1C3870EFE3870C02800C0000000000000000
-00C40211124400000000000000000000000000003244891224306081848908243090810489081848612243091218489081048912183091210489122448412244890C24204122430908242091210204122448912104890C01000C0000000000000000
-00C40211200400000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101402800C0000000000000000
-00C40211200400000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101401000C0000000000000000
-00C4021E201800000000000000000000000000003408102040489082481008404900810810082480920404902024810081081020244902010810204080420408101240204204049008402102010204204081020108101402800C0000000000000000
-00C40212220400000000000000000000000000003448112244FDF887E8900840FD10810891087E89FA240FD0227E8100810890207EFD12210811224488420448113F442042044FD108402102210204204081120108103C01000C0000000000000000
-00C402112204000000000000000000000000000034481122448508842890084085108108910842890A2408502242810081089020428512210811224488420448112144204204485108402102210204204081120108102402800C0000000000000000
-00C40211124400000000000000000000000000003244091224850884248808208490810489084249092208481242408081048810428491210409122448410244092124204102484908202081210204102040910104082401000C0000000000000000
-00C402110E38000000000000000000000000000031C3870E1C8508842387081C847081038708423908E1C8470E4238708103870E428470E103870E1C3840E1C387211C2040E1C847081C2070E102040E1C3870E103872402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-T 283 8 136 210.72726 98 778 22 T 1 db
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000401000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C41FDE2210000000000000000000000000000031C3BF8E1C3BF8CFE3070EFE3860EFFFC70EFE3070C1C3870EFE3870CFFFC77F1C33FFF1C3860EFFFC77F1C3BF8E1C3BFFF1C3860CFE3870E19FFF8C1C3870C1C3870C01000C0000000000000000
-00C402112230000000000000000000000000000032448412244840C103091210486121020912103090C2448912104890C102090824304082448612102090824484122448408244860C1048912182040C244890C244891402800C0000000000000000
-00C40211225000000000000000000000000000003408042040804121049020108092010210201049012408102010810121021008404840840809201021008408042040804084080912108102024204124081012408102401000C0000000000000000
-00C40211221000000000000000000000000000003408042040804121049020108092010210201049012408102010810121021008404840840809201021008408042040804084080912108102024204124081012408102402800C0000000000000000
-00C4021E3E1000000000000000000000000000003408042040804121049020108092010210201049012408102010810121021008404840840809201021008408042040804084080912108102024204124081012408102401000C0000000000000000
-00C402122210000000000000000000000000000034488422448043F10FD1201081FA2102112210FD13F4481020108913F102110844FC4084081FA21021108408842244884084089FBF10810207E2043F448103F408102402800C0000000000000000
-00C4021122100000000000000000000000000000344884224480421108512010810A210211221085121448102010891211021108448440840810A210211084088422448840840890A1108102042204214481021408102401000C0000000000000000
-00C402112210000000000000000000000000000032448412244042110849101041092102091210849212440810104892110209082484408204109210209082048412244840820490A1104081042204212440821204081402800C0000000000000000
-00C402112210000000000000000000000000000031C3840E1C38421108470E103908E102070E10847211C3870E103872110207081C844081C3908E10207081C3840E1C384081C390A1103870E42204211C387211C3870C01000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000402800C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C40000000000000000000000000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400040C0000000000000000
-00C41FDE3E1000000000000000000000000000003183870EFFFC77F183877F1C3070EFE3877FFE3070C1C3870E183870E1DFC70CFE3060E1C3BF8E183877F1C3877F1C3BFFF1C3060EFE3870C1DFC70C1C3870EFE3070C00040C0000000000000000
-00C4021108300000000000000000000000000000318489121020908184890824309121048908103090C24489121848912242090C103061224484121848908244890824484082430612104890C242090C2448912103091400040C0000000000000000
-00C40211085000000000000000000000000000003248102010210082481008404902010810081049012408102024810204021012104892040804202481008408100840804084048920108101240210124081020104902400040C0000000000000000
-00C40211081000000000000000000000000000003248102010210082481008404902010810081049012408102024810204021012104892040804202481008408100840804084048920108101240210124081020104902400040C0000000000000000
-00C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC7FFC0C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-T 283 8 136 218.69564 98 778 23 T 1 db
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080180000418080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C0000000000000000000000000000000000000008038000041C080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C0000000000000000000000000000000000000008078000041E080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080F8000041F0BFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA80400000C0000000000000000
-00C00000000000000000000000000000000000000080F8000041F0BFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF555555555555555555555555555555540400000C0000000000000000
-00C0000000000000000000000000000000000000008078000041E0BFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA80400000C0000000000000000
-00C0000000000000000000000000000000000000008038000041C080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080180000418080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000080000000400080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000400000C0000000000000000
-00C00000000000000000000000000000000000000F8FFFFFFFFFFF80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000007C00000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C001E0000000000F00000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C001860000000043000000001E0000030180000C1F01E019F80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-T 283 8 136 226.72726 98 778 22 T 1 db
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C001E0000000000F00000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C001860000000043000000001E0000030180000C1F01E019F80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0018600000000C300000000330000030780000C19833039F80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C00186361F1E37F301B0F0F9B301E3C33180001618C61858180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C001863B303336C301D99981B30336633180001618C61898300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00C0018633383338C3019999C0330306630180002618C61918300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000C0000000000000000
-00000186331E3F30C3019998F0330306630180003F18C619FC60000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0008018633073030C301999838330306630180006318C619FC60000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008018633033130C301999819B30316633180006319833018C0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-00080186333E1E307301F0F1F19E01E3C3318000631F01E018C0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-000801E0000000000F0180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008000000000000000180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0008000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-0000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000
-00003FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0040000000000000000
-007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFC0000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-T 283 9 136 234.78259 98 778 23 T 1 db
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-82 245 gm
-(nc 73 244 85 330 6 rc)kp
-0 gr
-T 1 setTxMode
-2 F /|______Times-Roman fnt
--0.11044 0.(Command menus)ashow
-256 425 gm
-(nc 247 424 259 474 6 rc)kp
--0.07157 0.(Scrollbars)ashow
-247 144 gm
-(nc 238 143 250 195 6 rc)kp
--0.13261 0.(Status line)ashow
-184 92 gm
-(nc 175 91 199 123 6 rc)kp
-(Short)show
-196 92 gm
--0.16336 0.(names)ashow
-85 416 gm
-(nc 76 415 100 464 6 rc)kp
--0.13940 0.(Sequence)ashow
-97 416 gm
--0.24850 0.(alignment)ashow
-(nc 72 90 269 544 6 rc)kp
-pr
-140 195 pl
-129 186 pl
-127 189 pl
-126 192 pl
-140 195 pl
-0 gr
-1 ep
-94 172 gm
-127 189 0 gr
-lin
-pr
-157 361 pl
-145 368 pl
-147 371 pl
-150 373 pl
-157 361 pl
-1 ep
-103 415 gm
-147 371 0 gr
-lin
-pr
-184 397 pl
-196 406 pl
-197 403 pl
-198 399 pl
-184 397 pl
-1 ep
-247 424 gm
-197 403 0 gr
-lin
-pr
-229 325 pl
-228 340 pl
-232 339 pl
-235 338 pl
-229 325 pl
-1 ep
-247 424 gm
-232 339 0 gr
-lin
-pr
-166 136 pl
-178 129 pl
-176 126 pl
-173 124 pl
-166 136 pl
-1 ep
-184 118 gm
-176 126 0 gr
-lin
-94 137 gm
-(nc 85 136 97 170 6 rc)kp
-0 gr
-T 1 setTxMode
-(Cursor)show
-265 218 gm
-(nc 256 217 268 327 6 rc)kp
--0.10447 0.(Split screen drag point)ashow
-(nc 72 90 269 544 6 rc)kp
-pr
-225 384 pl
-235 373 pl
-232 372 pl
-228 370 pl
-225 384 pl
-0 gr
-1 ep
-256 325 gm
-232 372 0 gr
-lin
-167 472 gm
-(nc 158 471 170 543 6 rc)kp
-0 gr
-T 1 setTxMode
--0.16412 0.(Scroll elevator)ashow
-(nc 72 90 269 544 6 rc)kp
-pr
-148 397 pl
-147 412 pl
-151 411 pl
-154 410 pl
-148 397 pl
-0 gr
-1 ep
-161 465 gm
-151 411 0 gr
-lin
-pr
-129 228 pl
-115 229 pl
-116 232 pl
-117 236 pl
-129 228 pl
-1 ep
-84 243 gm
-116 232 0 gr
-lin
-131 460 gm
-(nc 122 459 134 515 6 rc)kp
-0 gr
-T 1 setTxMode
--0.13102 0.(Resize tabs)ashow
-(nc 72 90 269 544 6 rc)kp
-pr
-119 401 pl
-118 416 pl
-122 415 pl
-125 414 pl
-119 401 pl
-0 gr
-1 ep
-129 454 gm
-122 415 0 gr
-lin
-pr
-229 399 pl
-215 404 pl
-217 407 pl
-220 410 pl
-229 399 pl
-1 ep
-164 445 gm
-217 407 0 gr
-lin
-153 454 gm
-137 465 lin
-300 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-10 fz
-2 F /|______Times-Roman fnt
-0.08865 0. 32 0.00886 0.(This is the sequence alignment editor. It consists of a color alignment display, a set of command menus,)awidthshow
-311 90 gm
-0.00823 0. 32 0.00082 0.(horizontal and vertical scroll bars to navigate the alignment, a list of short sequence names \(usually the)awidthshow
-322 90 gm
-0.02410 0. 32 0.00241 0.(LOCUS of a Genbank entry\), and a status line. The cursor is located in the upper left corner.)awidthshow
-355 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.07032 0.(Using the Mouse)ashow
-378 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.02319 0.(The mouse follow OpenLook standards for operation. The functions for each button are:)ashow
-0 0 gm
-(nc 391 90 498 329 6 rc)kp
-64 gr
-411 178 497 239 17.5 17.5 1 rr
-0 gr
-411.5 178.5 496.5 238.5 17.5 17.5 0 rr
-64 gr
-426 189 460 197 17.5 17.5 1 rr
-0 gr
-426.5 189.5 459.5 196.5 17.5 17.5 0 rr
-64 gr
-426 205 460 212 17.5 17.5 1 rr
-0 gr
-426.5 205.5 459.5 211.5 17.5 17.5 0 rr
-64 gr
-426 220 460 227 17.5 17.5 1 rr
-0 gr
-426.5 220.5 459.5 226.5 17.5 17.5 0 rr
-142 315 107 239 th
-441 92 gm
-tu
-(nc 434 91 443 153 6 rc)kp
-ts
-0 gr
-T 1 setTxMode
-12 fz
-2 F /|______Times-Roman fnt
--0.24205 0.(Object selection)ashow
-tu
-ts
-450 92 gm
-tu
-(nc 443 91 452 165 6 rc)kp
-ts
--0.14672 0.(clicking & dragging)ashow
-tu
-ts
-441 270 gm
-tu
-(nc 434 269 443 328 6 rc)kp
-ts
--0.20312 0.(Menu selection)ashow
-tu
-ts
-450 270 gm
-tu
-(nc 443 269 452 302 6 rc)kp
-ts
--0.09335 0.(dragging)ashow
-tu
-441 151 gm
-(nc 391 90 498 329 6 rc)kp
-441 189 0 gr
-lin
-433 182 449 198 165 195 1 ar
-441 265 gm
-441 231 lin
-433 224 449 239 345 375 1 ar
-ts
-399 186 gm
-tu
-(nc 392 186 401 237 6 rc)kp
-ts
-0 gr
-T 1 setTxMode
--0.22036 0.(Object adjust)ashow
-tu
-403 208 gm
-(nc 391 90 498 329 6 rc)kp
-426 208 0 gr
-lin
-418 201 434 217 255 285 1 ar
-518 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-10 fz
-2 F /|______Times-Roman fnt
-0.01296 0. 32 0.00129 0.(The left mouse button is used for placing the cursor, selecting sequences by their short)awidthshow
-529 90 gm
-0.16891 0. 32 0.01689 0.(names, scrolling/paging, performing split screens, and resizing. The right button is used for pop up menus,)awidthshow
-540 90 gm
--0.01223 0.(and scrollbar menus. The middle button is used for extending a text selection.)ashow
-562 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.11749 0.(Cursor Movement)ashow
-585 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-(The cursor can be moved using the arrow keys, or by clicking the mouse within a sequence. The cursors)show
-596 90 gm
-0.14465 0. 32 0.01446 0.(position is displayed on the status line in both sequence position and alignment column number. The right)awidthshow
-607 90 gm
-0.06561 0. 32 0.00656 0.(hand side of the status line shows the left and right column positions of the currently active display.)awidthshow
-629 90 gm
-0.07385 0. 32 0.00738 0.(Scrolling is controlled by the scrollbar elevator. By clicking \(left mouse button\) on one of the elevator)awidthshow
-640 90 gm
--0.03851 0.(arrows, the screen will scroll one character in that direction. By dragging the elevator center, the screen can)ashow
-651 90 gm
--0.00059 0.(be moved directly to any location. By clicking directly to one side of the elevator, the screen will scroll one)ashow
-662 90 gm
-0.07583 0. 32 0.00758 0.(full screen in that direction. And by clicking on the scrollbar anchor, the elevator will move to that anchor.)awidthshow
-673 90 gm
-0.20538 0. 32 0.02053 0.(Scrollbars also have menus associated with them giving other scroll options. Use the right mouse button to)awidthshow
-684 90 gm
-(activate the menu.)show
-F T cp
-%%Page: ? 5
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(5)show
-92 90 gm
--0.12741 0.(Selecting Sequences)ashow
-115 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.05250 0.(Sequence selection is necessary before most functions can be performed. Selecting sequences is)ashow
-126 90 gm
--0.03315 0.(accomplished by clicking or dragging \(left button\) over the short name associated with the sequence\(s\). The)ashow
-137 90 gm
--0.01461 0.(name of the sequence should become highlighted on the release of the mouse button. By holding down the)ashow
-148 90 gm
-0.13977 0. 32 0.01397 0.(shift key, you can toggle the selection on or off for any set of sequences. By clicking just to the right of)awidthshow
-159 90 gm
--0.00563 0.(any sequence short name, you will deselect all of them.)ashow
-181 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.20321 0.(Selecting Text)ashow
-204 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.00436 0.(Selecting text is accomplished in much the same way as selecting entire sequences. In the editing window,)ashow
-215 90 gm
-0.04013 0. 32 0.00401 0.(you can drag the mouse pointer over a rectangular region the select a block of text. By using the shift key)awidthshow
-226 90 gm
--0.01466 0.(\(or the middle mouse button\) you can adjust the selection to include other sequences, or other columns of)ashow
-237 90 gm
--0.01264 0.(text. If groups are enabled, GDE will automatically select all sequences in a group if any one sequence in a)ashow
-248 90 gm
--0.07606 0.(group is selected \(See Sequence Editing\).)ashow
-270 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.12741 0.(Sequence Protection)ashow
-293 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.05520 0.(All sequences can be individually protected against accidental modification. This is accomplished by)ashow
-304 90 gm
--0.01127 0.(selecting the set of sequences that you are interested in editing, and choosing the "Set protections" menu)ashow
-315 90 gm
-0.03738 0. 32 0.00373 0.(item under the File menu. Your choices are:)awidthshow
-337 90 gm
--0.03042 0.(Unambiguous modification)ashow
-337 306 gm
--0.13563 0.(Changing/adding/deleting regular characters)ashow
-348 90 gm
--0.02313 0.(Ambiguous changes)ashow
-348 306 gm
-0.28198 0. 32 0.02819 0.(Changing ambiguous codes \('N', 'X'...\))awidthshow
-359 90 gm
--0.01168 0.(Alignment modifications)ashow
-359 306 gm
-0.23391 0. 32 0.02339 0.(Changing alignment gaps \('-', '~'\))awidthshow
-381 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.15385 0.(Sequence Editing)ashow
-404 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.04483 0.(Sequences can be edited by simply typing to insert, and using the delete or backspace key to delete characters.)ashow
-415 90 gm
-0.05371 0. 32 0.00537 0.(Sequences must have the proper protections set to allow the type of modifications that you are attempting.)awidthshow
-426 90 gm
-0.06790 0. 32 0.00679 0.(The default protection level only allows modification to the alignment, but not to the sequences themselves.)awidthshow
-437 90 gm
--0.00852 0.(The Sun function keys, cut, copy and paste are used to edit selected text. Text selections work in rectangular)ashow
-448 90 gm
-(\(possibly disjointed\) regions. You can cut or copy a block of sequence text, and paste it to a new cursor)show
-459 90 gm
-0.10787 0. 32 0.01078 0.(location using these three keys.)awidthshow
-F T cp
-%%Page: ? 6
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(6)show
-92 90 gm
--0.11007 0.(Repeat Counts)ashow
-115 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.02497 0.(By typing a numeric value before an editing function you can insert, delete or move a number of characters at)ashow
-126 90 gm
--0.00587 0.(a time. The current repeat count is displayed on the status line, and can be cleared by clicking the left mouse)ashow
-137 90 gm
-0.08789 0. 32 0.00878 0.(button in the alignment window. In order to insert twenty gaps into a sequence, one would type "20-". In)awidthshow
-148 90 gm
--0.02253 0.(order to move down five sequences, one would type "5)ashow
-{}mark F /Symbol /|______Symbol 0 rf
-7 fz
-2 F /|______Symbol fnt
-(\257)show
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.02194 0.(". This works with all sequence types, however the)ashow
-159 90 gm
--0.01254 0.(meta \(diamond\) key must be held down when the cursor is in a text or mask sequence. This is because)ashow
-170 90 gm
--0.07215 0.(numbers are valid characters in these sequences, and would otherwise be confused with repeat counts.)ashow
-192 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.11955 0.(Split Screen)ashow
-215 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.11734 0. 32 0.01173 0.(Split screen editing allows the viewing one region while editing another. This is very useful for aligning)awidthshow
-226 90 gm
--0.03680 0.("downstream" regions by editing "upstream".)ashow
-248 90 gm
-0.14480 0. 32 0.01448 0.(The alignment window can be split horizontally into two or more windows into the alignment. These)awidthshow
-259 90 gm
--0.03460 0.(windows scroll independently of each other both horizontally and vertically. The short names displayed to)ashow
-270 90 gm
--0.01350 0.(the left of the alignment correspond to the window that was last scrolled or edited. Care should be taken in)ashow
-281 90 gm
--0.04472 0.(any modifications done in this mode so that edits are performed on the correct sequence. To avoid confusion)ashow
-292 90 gm
-0.00595 0. 32 0.00059 0.(during split screen operations, the vertical scroll bars may be locked so that all windows scroll together.)awidthshow
-0 0 gm
-(nc 294 162 447 412 6 rc)kp
-64 gr
-295 163 415 411 1 rc
-0 gr
-T 248 15.90908 163 295 70 554 35 T 1 db
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0000000
-00001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0020000
-00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020020000
-0007F3FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE7E20000
-00040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00040000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00040000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00040000020000000000000000000000000000000000000000000000000030000000000000000003000000000000000000000000000000000000000000000000000000020000
-0004001FC200000000000000000000000000000000000000000F0000000430003E00080007E00003000000000000008000000000000000000000000000000000000000020000
-003C001F820000000000000000000000000000000000000000198000000C000033001800060000000000000000000180000000000000000000000000000000000000001E0000
-0060000F020000000000000000000000000000000000000000300F0D879F31E0318F3E780606C66336786C3661E1B3E000000000000000000000000000000000000000060000
-0060000F02000000000000000000000000000000000000000030198ECCCC3330319998CC0607666336CC763BB331D98000000000000000000000000000000000000000060000
-0060000602000000000000000000000000000000000000000030198CCCCC33003181980C07C6666338CC66333331998000000000000000000000000000000000000000060000
-00600006020000000000000000000000000000000000000000319F8CCFCC3300318F987C0606634330CC663333F1998000000000000000000000000000000000000000060000
-0060000002000000000000000000000000000000000000000031980CCC0C3300319998CC0606634330CC66333301998000000000000000000000000000000000000000060000
-0060000002000000000000000000000000000000000000000019988CCC4C3310331998CC0606618330CC66333311998000000000000000000000000000000000000000060000
-006000000200000000000000000000000000000000000000000F8F0CC78731E03E0ECE7607E661833078663331E198E000000000000000000000000000000000000000060000
-00600000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-006000FFFC0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000460000
-0061FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC60000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC60000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-T 248 15 163 310.88232 70 554 34 T 1 db
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000088000000800000001100000040000000000002000000000010000000000000100000008000000000000000000200000000000000000000000000000000000060000
-00600007888000000400001F011100000200000F8210C0278421800000800001E00010010000000400001F002000000000100000000000000000000000000000000000060000
-00600004008000000400001001010000020000084310C04446218000008000011000100000000004000010002000000000100000000000000000000000000000000000060000
-00600004088E00FE020000100F13C07F01000008231120444622401FC040000112C63CE11600FE02000010227ACE1C03F8080000000000000000000000000000000000060000
-00600004089100FC020000101111007E01000008229120844522401F80400001130911111900FC020000102223112003F0080000000000000000000000000000000000060000
-00600007889100780200001E1111003C0100000822D1208785A2400F00400001121091111100780200001E1422012001E0080000000000000000000000000000000000060000
-00600004089F0078020000101111003C010000082253F08484A7E00F00400001E21091F11100780200001008220F1801E0080000000000000000000000000000000000060000
-006000040890003002000010111100180100000822321104446420060040000102109101110030020000101422110400C0080000000000000000000000000000000000060000
-006000040891003002000010131100180100000842321104446420060040000102091111110030020000102222110400C0080000000000000000000000000000000000060000
-00600004088E00000200001F0D10C0000100000F82121204442420000040000102060CE11100000200001F221A0EB80000080000000000000000000000000000000000060000
-00600000000000000400000000000000020000000000020000000000008000000000000000000004000000000000000000100000000000000000000000000000000000060000
-00600000000000000400000000000000020000000000000000000000008000000000000000000004000000000000000000100000000000000000000000000000000000060000
-00600000000000000800000000000000040000000000000000000000010000000000000000000008000000000000000000200000000000000000000000000000000000060000
-00600400000000001000080000000000080004000000000000000000020001000000000000000010000800000000000000400000000000000000000000000000000000060000
-006003000000000060000600000000003000030000000000000000000C0000C00000000000000060000600000000000001800000000000000000000000000000000000060000
-006000FFFFFFFFFF800001FFFFFFFFFFC00000FFFFFFFFFFFFFFFFFFF000003FFFFFFFFFFFFFFF800001FFFFFFFFFFFFFE000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE00023FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001FF00000000000000000000000000000000200023FC000000000000000000000000000000000000000000000020002060000
-T 248 15 163 325.90908 70 554 33 T 1 db
-0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE00023FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE0002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001FF00000000000000000000000000000000200023FC000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001FF00000000000000000000000000000000200023FC000000000000000000000000000000000000000000000020002060000
-00620FEF060878000000000000000000000000001F11C0070E1DFC67F183877F1C3070EFE3863FFE3C47001C3877F19FC60E1DFC70C1C3BF8E1C3800C1C3070E1E3FFE060000
-00620108861844000000000000000000000000001ED24009122420608184890824309121048A00003B490024489081820612242090C2448412244800C2430912260000060000
-00620108892844000000000000000000000000001DF400102040209082481008404902010812000037D000408100824209204021012408042040800124049020420000060000
-00620108890844000000000000000000000000001DF400102040209082481008404902010812000037D000408100824209204021012408042040800124049020420000060000
-0062010F090878000000000000000000000000001DF400102040209082481008404902010812000237D000408100824209204021012408042040800124049020420002060000
-006201091F8844000000000000000000000000001DD44011224021F887E8900840FD12010892000237510044890087E21FA2402103F4480422448803F44FD120460002060000
-00620108908844000000000000000000000000001DD4401122402108842890084085120108920002375100448900842210A24021021448042244880214485120460002060000
-00620108908844000000000000000000000000001ED24009122021088424880820849101048A00023B4900244880842210922020821244041224480212484910260002060000
-00620108908878000000000000000000000000001F11C0070E1C2108842387081C8470E1038601823C47001C38708422108E1C207211C3840E1C380211C8470E1E0182060000
-00620000000000000000000000000000000000001FF00000000000000000000000000000000203C23FC0000000000000000000000000000000000000000000000203C2060000
-00620000000000000000000000000000000000001FF00000000000000000000000000000000207E23FC0000000000000000000000000000000000000000000000207E2060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020FF2200000000000000000000000000000000000000000000000020FF2060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020FF2200000000000000000000000000000000000000000000000020FF2060000
-00620FEF0700000000000000000000000000000018E1C3870E1DFC07F183070C18307001C386000223870E1C3877F01FC60C1C3060C1C0070E1DFFF8CFE0077F1A0002060000
-006201088900000000000000000000000000000019224489122420008183090C18309002448A00022489122448908002060C243060C2400912242040C10009081A0002060000
-00620108900000000000000000000000000000001A04081020402000824490122449000408120002281020408100800209124048912400102040204121001008260002060000
-00620108900000000000000000000000000000001A04081020402000824490122449000408120002281020408100800209124048912400102040204121001008260002060000
-0062010F100000000000000000000000000000001A04081020402000824490122449000408120002281020408100800209124048912400102040204121001008260002060000
-00620109100000000000000000000000000000001A2448112044200087EFD03F7EFD10040892000228912044811080021FBF40FDFBF4401022442043F10011087E0002060000
-00620108900000000000000000000000000000001A24481120442000842850214285100408920002289120448110800210A140850A1440102244204211001108420002060000
-006201088800000000000000000000000000000019224409102420008428482142849002048A0002248910244090800210A120850A1240081224204211000908420002060000
-006201088700000000000000000000000000000018E1C3870E1C20008428472142847001C386000223870E1C3870800210A11C850A11C0070E1C204211000708420002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620FEF1C08000000000000000000000000000018E1C0060E1C3877F183BFFF1C3077F1C3860002238700183870E1DFC60EFFFC70C1DFC70E1DFFF8C1C3067F1A0002060000
-006201089218000000000000000000000000000019224006122448908184840824309082448A000224890018489122420612102090C2420912242040C24306081A0002060000
-00620108912800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000
-00620108910800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000
-0062010F110800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000
-00620109110800000000000000000000000000001A24401FA240891087E8840840FD1084089200022891007E890224421FA2102103F4421022442043F44FDF887E0002060000
-T 248 15 163 340.88232 70 554 34 T 1 db
-00620108912800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000
-00620108910800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000
-0062010F110800000000000000000000000000001A04000920408100824804084049008408120002281000248102040209201021012402102040204124048908260002060000
-00620109110800000000000000000000000000001A24401FA240891087E8840840FD1084089200022891007E890224421FA2102103F4421022442043F44FDF887E0002060000
-00620108910800000000000000000000000000001A244010A2408910842884084085108408920002289100428902244210A21021021442102244204214485088420002060000
-006201089208000000000000000000000000000019224010922048908424840820849082048A3FFE248900424881224210921020821242081224204212485088423FFE060000
-006201089C08000000000000000000000000000018E1C0108E1C3870842384081C847081C3860002238700423870E1C2108E10207211C2070E1C204211C85088420002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620FEF1F08000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C3860FF223BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A0FF2060000
-0062010890180000000000000000000000000000192104891224200082448412103090C2448A0FF224841224489080020912104840C2430912244890C24486121A0FF2060000
-00620108902800000000000000000000000000001A010810204020008408042010490124081207E22804204081008002102010804124049020408101240809202607E2060000
-00620108900800000000000000000000000000001A010810204020008408042010490124081203C22804204081008002102010804124049020408101240809202603C2060000
-0062010F1E0800000000000000000000000000001A01081020402000840804201049012408120182280420408100800210201080412404902040810124080920260182060000
-00620109100800000000000000000000000000001A210810204020008408842010FD13F44892000228842040810080021022108043F44FD122408103F4489FA07E0002060000
-00620108900800000000000000000000000000001A210810204020008408842010851214489200022884204081008002102210804214485122408102144890A0420002060000
-006201089008000000000000000000000000000019210408102020008204841010849212448A0002248410204080800208121040421248491220408212449090420002060000
-006201089F08000000000000000000000000000018E103870E1C200081C3840E10847211C386000223840E1C38708002070E10384211C8470E1C387211C3908E420002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000023FFE200000000000000000000000000000000000000000000000023FFE060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020000200000000000000000000000000000000000000000000000020000060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF1F1C000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C38601C023BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A01C0060000
-0062010890220000000000000000000000000000192104891224200082448412103090C2448A01C024841224489080020912104840C2430912244890C24486121A01C0060000
-00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000
-00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000
-0062010F1E0400000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000
-00620109100800000000000000000000000000001A210810204020008408842010FD13F4489201C028842040810080021022108043F44FD122408103F4489FA07E01C0060000
-00620108901000000000000000000000000000001A210810204020008408842010851214489201C02884204081008002102210804214485122408102144890A04201C0060000
-006201089020000000000000000000000000000019210408102020008204841010849212448A01C02484102040808002081210404212484912204082124490904201C0060000
-006201089F3E000000000000000000000000000018E103870E1C200081C3840E10847211C38601C023840E1C38708002070E10384211C8470E1C387211C3908E4201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF1F1C000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C38601C023BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A01C0060000
-T 248 15 163 355.90908 70 554 33 T 1 db
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF1F1C000000000000000000000000000018EFE3870E1DFC07F1C3BF8EFE3070C1C38601C023BF8E1C3877F01FC70EFE3BF8C1C3070E1C3870C1C3860E1A01C0060000
-0062010890220000000000000000000000000000192104891224200082448412103090C2448A01C024841224489080020912104840C2430912244890C24486121A01C0060000
-00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000
-00620108900200000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000
-0062010F1E0C00000000000000000000000000001A010810204020008408042010490124081201C02804204081008002102010804124049020408101240809202601C0060000
-00620109100200000000000000000000000000001A210810204020008408842010FD13F4489201C028842040810080021022108043F44FD122408103F4489FA07E01C0060000
-00620108900200000000000000000000000000001A210810204020008408842010851214489201C02884204081008002102210804214485122408102144890A04201C0060000
-006201089022000000000000000000000000000019210408102020008204841010849212448A01C02484102040808002081210404212484912204082124490904201C0060000
-006201089F1C000000000000000000000000000018E103870E1C200081C3840E10847211C38601C023840E1C38708002070E10384211C8470E1C387211C3908E4201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF0F00000000000000000000000000000018E1C3870E1C0067F183877F1C3077F1C38601C023870E1C3870019FC60E1DFC70C1DFC70E1C03F8C1C3070E1A01C0060000
-006201088800000000000000000000000000000019224489122400608184890824309082448A01C024891224489001820612242090C2420912240040C24309121A01C0060000
-00620108880000000000000000000000000000001A040810204000908248100840490084081201C02810204081000242092040210124021020400041240490202601C0060000
-00620108880000000000000000000000000000001A040810204000908248100840490084081201C02810204081000242092040210124021020400041240490202601C0060000
-0062010F0F0000000000000000000000000000001A040810204000908248100840490084081201C02810204081000242092040210124021020400041240490202601C0060000
-00620109080000000000000000000000000000001A240810224401F887E8900840FD1084089201C028902040891007E21FA2402103F4421022440043F44FD1207E01C0060000
-00620108880000000000000000000000000000001A240810224401088428900840851084089201C0289020408910042210A240210214421022440042144851204201C0060000
-006201088800000000000000000000000000000019220408122401088424880820849082048A01C02488102048900422109220208212420812240042124849104201C0060000
-006201088800000000000000000000000000000018E1C3870E1C0108842387081C847081C38601C023870E1C38700422108E1C207211C2070E1C004211C8470E4201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF0708000000000000000000000000000018E003870E1C3877F183BFFF1C3067F0038601C023800E1C3870E1DFC60EFFFC70C19FC00E1C03F8C1C3060E1E01C0060000
-006201088918000000000000000000000000000019200489122448908184840824306080048A01C024801224489122420612102090C1820012240040C24306122601C0060000
-00620108902800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000
-00620108900800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000
-0062010F100800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000
-00620109110800000000000000000000000000001A2008112244811087E8840840FDF880089201C028802044891204421FA2102103F7E20022440043F44FDFA04601C0060000
-00620108910800000000000000000000000000001A200811224481108428840840850880089201C0288020448912044210A210210214220022440042144850A04601C0060000
-006201088908000000000000000000000000000019200409122440908424840820850880048A01C02480102448910242109210208214220012240042124850902601C0060000
-T 248 15 163 370.88232 70 554 34 T 1 db
-0062010F100800000000000000000000000000001A000810204081008248040840489080081201C02800204081020402092010210122420020400041240489204201C0060000
-00620109110800000000000000000000000000001A2008112244811087E8840840FDF880089201C028802044891204421FA2102103F7E20022440043F44FDFA04601C0060000
-00620108910800000000000000000000000000001A200811224481108428840840850880089201C0288020448912044210A210210214220022440042144850A04601C0060000
-006201088908000000000000000000000000000019200409122440908424840820850880048A01C02480102448910242109210208214220012240042124850902601C0060000
-006201088708000000000000000000000000000018E003870E1C3870842384081C850880038601C023800E1C3870E1C2108E1020721422000E1C004211C8508E1E01C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF071C000000000000000000000000000018E003870E1C3867F1C3BF8CFE3067F0038601C023800E1C3870E19FC70EFE33F8C19FC00E1C3BF8CFFFC60E1E01C0060000
-006201088922000000000000000000000000000019200489122448608244840C10306080048A01C024801224489121820912103040C1820012244840C10206122601C0060000
-00620108900200000000000000000000000000001A000810204080908408041210489080081201C02800204081020242102010484122420020408041210209204201C0060000
-00620108900200000000000000000000000000001A000810204080908408041210489080081201C02800204081020242102010484122420020408041210209204201C0060000
-0062010F100400000000000000000000000000001A000810204080908408041210489080081201C02800204081020242102010484122420020408041210209204201C0060000
-00620109110800000000000000000000000000001A200811224481F88408843F10FDF880089201C028802044891207E2102210FC43F7E20022448043F1021FA04201C0060000
-00620108911000000000000000000000000000001A200811224481088408842110850880089201C02880204489120422102210844214220022448042110210A04201C0060000
-006201088920000000000000000000000000000019200409122441088204842110850880048A01C02480102448910422081210844214220012244042110210902201C0060000
-00620108873E000000000000000000000000000018E003870E1C390881C3842110850880038601C023800E1C3870E422070E1084421422000E1C38421102108E1E01C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF071C000000000000000000000000000018E003870E1C3067F183877F1C3077FFE38601C023800E1C3870C19FC60E1DFC70C1DFFF8E1C03F8C1C3070E1A01C0060000
-006201088922000000000000000000000000000019200489122430608184890824309081048A01C0248012244890C1820612242090C2420412240040C24309121A01C0060000
-00620108900200000000000000000000000000001A000810204048908248100840490081081201C02800204081012242092040210124020420400041240490202601C0060000
-00620108900200000000000000000000000000001A000810204048908248100840490081081201C02800204081012242092040210124020420400041240490202601C0060000
-0062010F100C00000000000000000000000000001A000810204048908248100840490081081201C02800204081012242092040210124020420400041240490202601C0060000
-00620109110200000000000000000000000000001A2008112244FDF887E8900840FD1081089201C0288020448913F7E21FA2402103F4420422440043F44FD1207E01C0060000
-00620108910200000000000000000000000000001A200811224485088428900840851081089201C0288020448912142210A240210214420422440042144851204201C0060000
-006201088922000000000000000000000000000019200409122485088424880820849081048A01C02480102448921422109220208212420412240042124849104201C0060000
-00620108871C000000000000000000000000000018E003870E1C8508842387081C847081038601C023800E1C38721422108E1C207211C2040E1C004211C8470E4201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF1108000000000000000000000000000018E1DFC70E1DFC67F183877F1C3077FFE38601C023877F1C3877F19FC60E1DFC70C1DFFF8E1C03F8C1C3070E1E01C0060000
-006201089118000000000000000000000000000019224209122420608184890824309081048A01C024890824489081820612242090C2420412240040C24309122601C0060000
-00620108912800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000
-T 248 15 163 385.90908 70 554 33 T 1 db
-006200000000000000000000000000000000000018000000000000000000000000000000000201C02000000000000000000000000000000000000000000000000201C0060000
-00620FEF1108000000000000000000000000000018E1DFC70E1DFC67F183877F1C3077FFE38601C023877F1C3877F19FC60E1DFC70C1DFFF8E1C03F8C1C3070E1E01C0060000
-006201089118000000000000000000000000000019224209122420608184890824309081048A01C024890824489081820612242090C2420412240040C24309122601C0060000
-00620108912800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000
-00620108910800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000
-0062010F1F0800000000000000000000000000001A040210204020908248100840490081081201C02810084081008242092040210124020420400041240490204201C0060000
-00620109110800000000000000000000000000001A244211224021F887E8900840FD1081089201C028910844890087E21FA2402103F4420422440043F44FD1204201C0060000
-00620108910800000000000000000000000000001A244211224021088428900840851081089201C0289108448900842210A240210214420422440042144851204201C0060000
-006201089108000000000000000000000000000019224209122021088424880820849081048A0000248908244880842210922020821242041224004212484910220000060000
-006201089108000000000000000000000000000018E1C2070E1C2108842387081C847081038600002387081C38708422108E1C207211C2040E1C004211C8470E1E0000060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-00620000000000000000000000000000000000001800000000000000000000000000000000020002200000000000000000000000000000000000000000000000020002060000
-0063FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE3FFE3FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE3FFE060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000040000000000000000000000000000000020000010000000000000000000000000000000000000000000000020000060000
-00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000
-00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000
-006000000000000000000000000000000000000000400C000020C040000000000000000000020000010030000083010000000000000000000000000000000000020000060000
-006000000000000000000000000000000000000000401C000020E040000000000000000000020000010070000083810000000000000000000000000000000000020000060000
-006000000000000000000000000000000000000000403C000020F0400000000000000000000200000100F0000083C10000000000000000000000000000000000020000060000
-006000000000000000000000000000000000000000407C000020F85D5555555555555555540200000101F0000083E17FFFD55555555555555555555555555554020000060000
-006000000000000000000000000000000000000000407C000020F85EAAAAAAAAAAAAAAAAAA0200000101F0000083E17FFFAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA020000060000
-006000000000000000000000000000000000000000403C000020F05D5555555555555555540200000100F0000083C17FFFD55555555555555555555555555554020000060000
-006000000000000000000000000000000000000000401C000020E040000000000000000000020000010070000083810000000000000000000000000000000000020000060000
-006000000000000000000000000000000000000000400C000020C040000000000000000000020000010030000083010000000000000000000000000000000000020000060000
-00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000
-00600000000000000000000000000000000000000040000000200040000000000000000000020000010000000080010000000000000000000000000000000000020000060000
-006000000000000000000000000000000000000007C7FFFFFFFFFFC00000000000000000003E00001F1FFFFFFFFFFF00000000000000000000000000000000003E0000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-T 248 15 163 400.88232 70 554 34 T 1 db
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-00600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-006000F0000000000780000000000000018000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000060000
-006000C30000000021800000000F00000180C0003FCF818183E000000000000000000000000000000000000000000000000000000000000000000000001E00001E3F00060000
-006000C30000000061800000001980000183C000060CC18783300000000000000000000000000000000000000000000000000000000000000000000000330000333F00060000
-006000C31B0F8F1BF980D8787CD980F1E198C000060CC2C183300000000000000000000000000000000000000000000000000000000000000000000000330000030300060000
-006000C31D98199B6180ECCCC0D9819B3198C000060C82C183200000000000000000000000000000000000000000000000000000000000000000000000330000030600060000
-006000C3199C199C6180CCCCE01981833180C000060F04C183C000000000000000000000000000000000000000000000000000000000000000000000003303F8060600060000
-000000C3198F1F986180CCCC781981833180C000060D87E1832000000000000000000000000000000000000000000000000000000000000000000000003300000C0C00000000
-000400C3198398186180CCCC1C1981833180C000060D8C6183300000000000000000000000000000000000000000000000000000000000000000000000330000180C00020000
-000400C3198198986180CCCC0CD9818B3198C000060CCC61833000000000000000000000000000000000000000000000000000000000000000000000003300003F1800020000
-000400C3199F0F183980F878F8CF00F1E198C000060CEC6183E000000000000000000000000000000000000000000000000000000000000000000000001E00003F1800020000
-000400F0000000000780C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00040000000000000000C00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00040000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000
-00001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0020000
-003FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF7FE0000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-48 gr
-391.5 255.5 446.5 314.5 90 180 0 ar
-391.5 255.5 446.5 314.5 0 90 0 ar
-0 0 2 9 9 2 dh
-419 314 gm
-425 321 lin
-rh
-psb
-pse
-0 0 2 9 9 2 dh
-419 314 gm
-425 307 lin
-rh
-psb
-pse
-0 0 pen
-400 238 gm
-400 238 lin
-nc ct 39 0 put
-pr
-409 256 pl
-400 238 pl
-418 247 pl
-409 256 pl
-1 ep
-1 1 pen
-409 256 gm
-bp
-400 238 T qi
-400 238 qc
-418 247 qc
-418 247 qc
-409 256 qc
-409 256 48 gr
-T qq
-qf
-qf
-ef
-15 ec
-(nc 294 162 447 412 6 rc)kp
-2 2 pen
-408 246 gm
-417 255 lin
-0 0 pen
-401 306 gm
-401 306 lin
-nc ct 39 0 put
-pr
-410 324 pl
-401 306 pl
-419 315 pl
-410 324 pl
-0 gr
-1 ep
-1 1 pen
-410 324 gm
-bp
-401 306 T qi
-401 306 qc
-419 315 qc
-419 315 qc
-410 324 qc
-410 324 0 gr
-T qq
-qf
-qf
-ef
-15 ec
-(nc 294 162 447 412 6 rc)kp
-2 2 pen
-409 314 gm
-418 323 lin
-1 1 pen
-467 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-2 F /|______Times-Roman fnt
-0.05432 0. 32 0.00543 0.(In order to split a window into two views, grab \(left button\) the left or right anchor \(small rectangle\) at)awidthshow
-478 90 gm
--0.02000 0.(either end of the horizontal scrollbar and drag to the middle of the window. This should split the window)ashow
-489 90 gm
-0.21789 0. 32 0.02178 0.(into two views. To join two views, place the mouse pointer on the horizontal scroll bar use the menu \(right)awidthshow
-500 90 gm
-0.61981 0. 32 0.06198 0.(button\) .)awidthshow
-522 90 gm
-(The views are NOT two copies of the alignment. Changes in one window are reflected in the other. Users)show
-533 90 gm
-0.00976 0. 32 0.00097 0.(should not be confused by this fact.)awidthshow
-555 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.06040 0.(Sequence Grouping)ashow
-578 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.00846 0.(Sequences can be grouped for editing functions. This is very helpful when trying to adjust several sub)ashow
-589 90 gm
--0.00823 0.(alignments. When grouped, all sequences within a group will be affected by editing in any member of the)ashow
-600 90 gm
-0.07675 0. 32 0.00767 0.(group. All sequences within a group must have protections set to allow modification before any one will be)awidthshow
-611 90 gm
--0.20011 0.(modified.)ashow
-633 90 gm
--0.03013 0.(In order to group sequences, select the names of the sequences that should fall within a group, and select)ashow
-644 90 gm
--0.02406 0.(Group under the Edit menu. A number will be placed at the left of the sequence representing its assigned)ashow
-655 90 gm
--0.04641 0.(group number. To any sequence or sequences, the user selects those sequences and uses the Ungroup)ashow
-666 90 gm
--0.06661 0.(command under the Edit menu.)ashow
-688 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.11912 0.(Special keys)ashow
-F T cp
-%%Page: ? 7
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(7)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01528 0.(There are also a few special function keys used in the GDE. Some functions have meta key equivalences so)ashow
-92 90 gm
--0.01637 0.(that they can be called from the keyboard, instead of by the menu system. The "meta" key is a standard)ashow
-103 90 gm
--0.05270 0.(property of X windows, and may be remapped to a different key symbol for different keyboards. For)ashow
-114 90 gm
-0.11459 0. 32 0.01145 0.(example, meta on Sun workstations is represented with a )awidthshow
-{}mark F /Symbol /|______Symbol 0 rf
-9 fz
-2 F /|______Symbol fnt
-(\340)show
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.11154 0. 32 0.01115 0.(, where on a Macintosh running MacX it might)awidthshow
-125 90 gm
-0.13610 0. 32 0.01361 0.(be the "apple" key. The operation of the key is the same as the control or shift key, it is held down while)awidthshow
-136 90 gm
--0.04826 0.(pressing the second key in the sequence.)ashow
-158 90 gm
-0.07690 0. 32 0.00769 0.(Cut text, copy text and paste text are mapped to the Openlook equivalent keys \(L10, L6, and L8 on Sun)awidthshow
-169 90 gm
--0.03259 0.(keyboards\). Other meta keys are defined in the .GDEmenus file, and may be changed to suit your)ashow
-180 90 gm
--0.23315 0.(preferences.)ashow
-205 90 gm
-14 fz
-2 F /|______Times-Roman fnt
--0.01499 0.(Data Types)ashow
-228 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.01342 0. 32 0.00134 0.(The GDE supports several data types. The data types supported in 2.0 are DNA, RNA, protein \(single letter)awidthshow
-239 90 gm
--0.08953 0.(codes\), mask sequence, and text.)ashow
-261 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.16458 0.(DNA and RNA)ashow
-284 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.06896 0.(Nucleic acid sequences are tightly type cast, and can contain any IUPAC code \(ACGTUM RSVWYHKDBN\))ashow
-295 90 gm
-0.00411 0. 32 0.00041 0.(as well as two alignment gap characters \('~' and '-'\). Some keys are remapped to fit IUPAC codes. For)awidthshow
-306 90 gm
-0.00274 0. 32 0.00027 0.(example, 'X' is mapped to 'N'. All nonstandard characters get mapped to the alignment gap '-'. Upper and)awidthshow
-317 90 gm
--0.06726 0.(lower case are both supported, and the T/U characters are mapped based on whether you are working with)ashow
-328 90 gm
--0.01962 0.(DNA or RNA. The color coding for DNA and RNA is identical. The color for ambiguous characters, and)ashow
-339 90 gm
-0.16555 0. 32 0.01655 0.(for alignment gaps is grey.)awidthshow
-361 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.20167 0.(Amino Acid Sequence)ashow
-384 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.04162 0.(Amino acid sequences are loosely type cast, and can contain any valid ASCII character. The results of)ashow
-395 90 gm
--0.09436 0.(analysis on nonstandard characters is not guaranteed. The color for nonstandard amino acid characters, and for)ashow
-406 90 gm
-0.24002 0. 32 0.02400 0.(alignment gaps is grey.)awidthshow
-428 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.16378 0.(Text Sequence)ashow
-451 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03298 0.(Any valid ASCII printable character can be entered into a text sequence. Care should be taken with using)ashow
-462 90 gm
--0.00344 0.(space characters, as these will only be saved properly in Genbank format, and not in flat file format. The)ashow
-473 90 gm
--0.04928 0.(characters @#% and " should be avoided as well, as these can confuse the reading of flat files if saved in that)ashow
-484 90 gm
--0.02505 0.(format.)ashow
-506 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.13627 0.(Mask Sequence)ashow
-529 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03303 0.(Mask sequence is identical to text sequence with the following exceptions. Mask sequence can have the)ashow
-540 90 gm
-0.06149 0. 32 0.00614 0.(ability \(function dependent\) of masking out positions in an alignment for analysis. If a mask sequence is)awidthshow
-551 90 gm
-0.01480 0. 32 0.00148 0.(selected along with some other sequence\(s\) for an analysis function that permits masking, then all columns)awidthshow
-562 90 gm
-0.06927 0. 32 0.00692 0.(that contain a '0' in the mask sequence will be ignored by the function. The mask itself would not be passed)awidthshow
-573 90 gm
-0.22354 0. 32 0.02235 0.(to the analysis function either. Some functions allow masking, some do not. Refer to the instruction page)awidthshow
-584 90 gm
--0.00167 0.(for each function to see whether or not it supports sequence masking.)ashow
-606 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.06585 0.(Color Masks)ashow
-629 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.01022 0. 32 0.00102 0.(Color masks give color to a sequence on a position by position basis. Individual sequences can have color)awidthshow
-640 90 gm
--0.01266 0.(masks attached to them, or one color mask can be used for an entire alignment. Color masks are generated)ashow
-651 90 gm
--0.00192 0.(externally by some analysis functions, and are then passed back to the GDE. The file format for a colormask)ashow
-662 90 gm
--0.07350 0.(is described in Appendix A.)ashow
-698 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.15777 0. 32 0.01577 0.(Menu Functions: File menu)awidthshow
-F T cp
-%%Page: ? 8
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(8)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.00126 0.(The GDE has several built-in menu functions under the File and Edit menus. These functions are unique in)ashow
-92 90 gm
--0.02758 0.(that they are part of the primary display editor, and are not described in the .GDEmenus file.)ashow
-126 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-0.33511 0.(Open...)ashow
-138 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.19515 0. 32 0.01951 0.(Selecting this will bring up the open file dialog box. Users can scroll through a list of files in the current)awidthshow
-149 90 gm
--0.07145 0.(directory, move up and down the directory tree, and open any individual data file. The sequence data in that)ashow
-160 90 gm
--0.02137 0.(file is loaded into the current editing window below any existing sequences. The open command will open)ashow
-171 90 gm
--0.01487 0.(any Genbank formatted file, or a GDE flat file.)ashow
-193 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-1.41235 0. 32 0.14123 0.(Save as...)awidthshow
-205 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.07537 0. 32 0.00753 0.(This function will save the entire alignment to a specified file in either Genbank or flat file format. The file)awidthshow
-216 90 gm
--0.00964 0.(will be saved in the local directory unless a relative or absolute path is specified.)ashow
-249 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-0.19628 0.(Properties...)ashow
-261 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.02334 0. 32 0.00233 0.(Properties controls the display settings. Those settings include character size, color type, and insert)awidthshow
-272 90 gm
--0.07415 0.(direction. The screen can also be inverted, vertical scroll lock and keyboard clicks \(tactile feedback\) can be)ashow
-283 90 gm
-0.11657 0. 32 0.01165 0.(turned on or off. Vertical scrollbar lock will cause all split views to scroll together in the vertical)awidthshow
-294 90 gm
--0.11550 0.(direction.)ashow
-0 0 gm
-(nc 296 234 431 370 6 rc)kp
-64 gr
-297 235 430 369 1 rc
-0 gr
-T 134 33.87997 235 297 40 305 77 T 1 db
-00000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000004000000000000000000000000000000000000000000000000000000000000000000018000
-C0000004000000000000000000000000000000000000000000000000000000000000000000018000
-C0000004000000000000000000000000000000000000018000000000000000000000000000018000
-C0003F8400000000000000000000000007C000000000218000000000000000000000000000018000
-C0002004000000000000000000000000066000000000600000000000000000000000000000018000
-C0001004000000000000000000000000066D9E1B0F1BF98F0F800000000000000000000000018000
-C0001004000000000000000000000000066DB31D999B619998000000000000000000000000018000
-C0000804000000000000000000000000064E3319999C61999C000000000000000000000000018000
-C0000804000000000000000000000000078C33199F98619F8F000000000000000000000000018000
-C0000004000000000000000000000000060C33199818619803800000000000000000000000018000
-C0000004000000000000000000000000060C33199898619881800000000000000000000000018000
-C0000004000000000000000000000000060C1E1F0F18398F1F000000000000000000000000018000
-C0000004000000000000000000000000000000180000000000000000000000000000000000018000
-C001FFF8000000000000000000000000000000180000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF18000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000004000000000000000000000000000000000000000000000000000000000000000018000
-C0000782102000000000000000000000000000000000000000000000000000000000000000018000
-C0000842202000000000000000000000000000000000000000000000000000000000000000018000
-C0001022401000000000000000000000000000000000000000000000000000000000000000018000
-C0001022801000000000000000000000000000000000000000000000000000000000000000018000
-C0001023801000000000000000000000000000000000000000000000000000000000000000018000
-C0001022401000000000000000000000000000000000000000000000000000000000000000018000
-C0001022201000000000000000000000000000000000000000000000000000000000000000018000
-C0000842101000000000000000000000000000000000000000000000000000000000000000018000
-C0000782101000000000000000000000000000000000000000000000000000000000000000018000
-C0000000002000000000000000000000000000000000000000000000000000000000000000018000
-C0000000002000000000000000000000000000000000000000000000000000000000000000018000
-C0000000004000000000000000000000000000000000000000000000000000000000000000018000
-C0080000008000000000000000000000000000000000000000000000000000000000000000018000
-C0060000030000000000000000000000000000000000000000000000000000000000000000018000
-C001FFFFFC0000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C000000C000000000000000000000000000000000000000000000000060000000000000000018000
-C007800C000010000000000000000000000000000000000FC0000807860000000000000000018000
-C00CC00C000030000000000000000000000000000000000C0000180CC00000000000000000018000
-C0180F0C78D87D8CD878000000000000000000000000000C1E1B3E0C067C78000000000000018000
-C018198CCCD8318CECCC000000000000000000000000000C331D980E060CCC000000000000018000
-C018198CCCE03188CCCC000000000000000000000000000FB31998078618CC000000000000018000
-C018198CCCC030D8CCFC000000000000000000000000000C33199801C638FC000000000000018000
-C018198CCCC030D0CCC0000000000000000000000000000C33199800C630C0000000000000018000
-C00C598CCCC03070CCC4000000000000000000000000000C3319980CC660C4000000000000018000
-C0078F0C78C01C60F878000000000000000000000000000C1E198E07867C78000000000000018000
-C0000000000000C0C000000000000000000000000000000000000000000000000000000000018000
-C0000000000000C0C000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-T 134 33 235 330.86840 40 305 76 T 1 db
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000080000000000000000000000000000000000000000000400000000000000000000000018000
-C0000080000080000000000000000001000000000000000000400000000220000000000000018000
-C000008000F080000000400000000001000000000000000000400082000220000000000000018000
-C007F0800108800000004000006000010000000000000003F84000C6000200000000000000018000
-C00400800200B0E2CE0EF38B00181C610C58000000000002004000C61C1E2222CC00000000018000
-C00200800200C9131110444C000420911260000000000001004000AA222222233200000000018000
-C002008002008812012044487F0241092140000000000001004000AA222222222200000000018000
-C0010080020088F20F2047C8000441092140000000000000804000923E2222222200000000018000
-C0010080020089121120440800184109214000000000000080400092202222222200000000018000
-C0000080010889121110444800602091124000000000000000400082222622622200000000018000
-C000008000F088EA0E8E338800001C610C40000000000000004000821C1A21A22200000000018000
-C0000080000000000000000000000000000000000000000000400000000000000000000000018000
-C0000080000000000000000000000000000000000000000000400000000000000000000000018000
-C03FFF00000000000000000000000000000000000000001FFF800000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C00000000000000000000000001FFFFFFFFFFFF80000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000318060000000000018000100000000000000000800004002000000000000000000000018000
-C01F83188600000000000180001008000000200000F0800004002000000000000000000000018000
-C0180301800000000000018000100800000020000108800004002000000000000000000000018000
-C0181F1BE6361F01B30F0F8F001008B0E38B78000200B0E0E4402000000000000000000000018000
-C0183319863B3301DD999999801008C9044C20000200C91104802000000000000000000000018000
-C01F3319863333019999999980100889044820000200891205002000000000000000000000018000
-C0183319863333019999999F80100888C7C82000020089F207002000000000000000000000018000
-C0183319863337019999999800100888240820000200890204802000000000000000000000018000
-C018371986331B0199999B9880100888244820000108891104C02000000000000000000000018000
-C01F9B18E6330301998F0D8F00100889C388180000F088E0E4402000000000000000000000018000
-C0000000000033000000000000100000000000000000000000002000000000000000000000018000
-C000000000001E000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C0000000000000000000000000100000000000000000000000002000000000000000000000018000
-C000000000000000000000000010000000000001FFFFFFFFFFFFE000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000030000000000000000000000018000
-C0000000000000000000000000000000000000000600000000430000000000000000000000018000
-C0000000000000000000000000000000000000000600000000C00000000000000000000000018000
-C00000000000000000000000000000000000000006361F1E37F31E1B000000000000000000018000
-C000000000000000000000000000000000000000063B303336C3331D800000000000000000018000
-C0000400000000000000080000000000000000000633383338C33319800000000000000000018000
-T 134 33 235 363.86840 40 305 76 T 1 db
-C0000000000000000000000000000000000000000600000000C00000000000000000000000018000
-C00000000000000000000000000000000000000006361F1E37F31E1B000000000000000000018000
-C000000000000000000000000000000000000000063B303336C3331D800000000000000000018000
-C0000400000000000000080000000000000000000633383338C33319800000000000000000018000
-C00004000400000008000800000000000000000006331E3F30C33319800000000000000000018000
-C0000400040000000800080000000000000000000633073030C33319800000000000000000018000
-C0000400045888E2DE70780000000000000000000633033130C33319800000000000000000018000
-C00004000464891308888800000000000000000006333E1E30731E19800000000000000000018000
-C0000400044489120888880000000000000000000000000000000000000000000000000000018000
-C0000400044451F208F8880000000000000000000000000000000000000000000000000000018000
-C0000400044451020880880000000000000000000000000000000000000000000000000000018000
-C0000400044421120888980000000000000000000000000000000000000000000000000000018000
-C0000400044420E20670680000000000000000000000000000000000000000000000000000018000
-C0000400000000000000000000000000000000000000000000000000000000000000000000018000
-C03FFC00000000000000000000000000000000000000000000000000000000000010000000018000
-C0000000000000000000000000000000000000000000000000000000000000000010000000018000
-C0000000000000000000000000000000000000000000000000000000000000000010000000018000
-C0000000000000000000000000000000000000000000000000000000000000000010000000018000
-C0000000000000000000000000000000000000000000000000000000000000000010000000018000
-C0000000000000000000000000000000000000000000000000000000000000000010000000018000
-C00000000000000000000000000000000000000000000801000000C0000000000010000000018000
-C000000000000000000000000000000000000000000F080101000100000000000010000000018000
-C0000000000000000000000000000000000000000008800101000100000000000010000000018000
-C000000000000000000000000000000000000000000888F163C063C072259C316010000000018000
-C0000000000000000000000000000000000000000008891191009100822620498010000000018000
-C000000000000000000000000000000000000000000F091111010901022420850010000000018000
-C0000000000000000000000000000000000000000009091111010901022418850010000000018000
-C0000000000000000000000000000000000000000008893111010901022404850010000000018000
-C000000000000000000000000000000000000000000888D111009100826404490010000000018000
-C0000000000000000000000000000000000000000008881110C0610071A438310010000000018000
-C0000000000000000000000000000000000000000000001000000000000000000010000000018000
-C000000000000000000000000000000000000000000000E000000000000000000010000000018000
-C0000400000000800000001000080000000880000000000000000000000000000010000000018000
-C0000400040000800000021000080000000880000000000000000000000000000010000000018000
-C0000400040000800000020000080000000880000000000000000000000000000010000000018000
-C0000400040C1C882238B790E7080E1D630880000000000000000000000000000010000000018000
-C0000400041220902244C21108881021848880000FFFFFFFFFFFFFFFFFFFFFFFFFF0000000018000
-C0000400042140A02244821200881041084880001FFFFFFFFFFFFFFFFFFFFFFFFFE0000000018000
-C0000400042140E0147C821207880C41084880001000000000000000000000000000000000018000
-C0000400042140901440821208880241084880001000000000000000000000000000000000018000
-C0000400041220980844821108880221048880001000000000000000000000000000000000018000
-C0000400078C1C8808388190E7481C1D030880001000000000000000000000000000000000018000
-C0000400000000000000000000000000000000001000000000000000000000000000000000018000
-C03FFC00000000000000000000000000000000001000003000018000000000000000000000018000
-C0000000000000000000000000000000000000001008004200020000000000000000000000018000
-C0000000000000000000000000000000000000001008004200020000000000000000000000018000
-C000000000000000000000000000000000000000100838F780C780E44B3862C00000000000018000
-C00000000000000000000000000000000000000010084442012201044C4093000000000000018000
-C000000000000000000000000000000000000000100844420212020448410A000000000000018000
-C00000000000000000000000000000000000000010087C420212020448310A000000000000018000
-C000000000000000000000000000000000000000100840420212020448090A000000000000018000
-C0000000000000000000000000000000000000001008444201220104C80892000000000000018000
-C000000000000000000000000000000000000000100F384180C200E3487062000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000001000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000400000000000440100000000000000000000000000000000000000000000000000000018000
-C0000400042000000440100000000000000000000000000000000000000000000000000000018000
-C0000400044000000400100000000000000000000000000000000000000000000000000000018000
-C000040004871100E443913800000000000000000000000000000000000000000000000000018000
-C0000400050891010444124000000000000000000000000000000000000000000000000000018000
-C0000400070891020448144000000000000000000000000000000000000000000000000000018000
-C0000400048F8A0204481C3000000000000000000000000000000000000000000000000000018000
-C000040004480A020448120800000000000000000000000000000000000000000000000000018000
-C0000400042884010444130800000000000000000000000000000000000000000000000000018000
-C000040004270400E443917000000000000000000000000000000000000000000000000000018000
-C0000400000008000000000000000000000000000000000000000000000000000000000000018000
-C03FFC00000018000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-T 134 34 235 396.89471 40 305 76 T 1 db
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000400000000000000000000000020000000000000000000000000000000000000000000018000
-C0000400041000000000000000000020000000000000000000000000000000000000000000018000
-C0000400063000000000000000000020000000000000000000000000000000000000000000018000
-C00004000630E1C71C3C700B0E161C20000000000000000000000000000000000000000000018000
-C0000400055112082244880C91192220000000000000000000000000000000000000000000018000
-C0000400055112080244880881112220000000000000000000000000000000000000000000018000
-C00004000491F1861E44F8088F113E20000000000000000000000000000000000000000000018000
-C000040004910041224C800891112020000000000000000000000000000000000000000000018000
-C0000400041110412234880891112220000000000000000000000000000000000000000000018000
-C00004000410E38E1D04700F0E911C20000000000000000000000000000000000000000000018000
-C0000400000000000004000800000000000000000000000000000000000000000000000000018000
-C03FFC00000000000038000800000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000300000000000000000000000400000000000000000000000000000000000000000018000
-C01E000030000020000000000200000040000000000000000000000000003C180000000000018000
-C0330000300000E0000000000E000000400000000000000000000000000042240000000000018000
-C0301E3C31E300200000000002000000400000000000000000000000000002420000000000018000
-C03833663333002000000000020000007FFFFFFFFFFFFFFFFFFFFFFFF80002420000000000018000
-C01E3006333000200000000002000000400000000000000000000000000004420000000000018000
-C007303E33F000200000000002000000400000000000000000000000000008420000000000018000
-C0033066330000200000000002000000400000000000000000000000000010420000000000018000
-C0333166331300220000000002000000400000000000000000000000000020240000000000018000
-C01E1E3B31E30025000000000200000040000000000000000000000000007E180000000000018000
-C00000000000000A8000000000000000400000000000000000000000000000000000000000018000
-C0000000000000154000000000000000400000000000000000000000000000000000000000018000
-C00000000000000A800000100000007F800000000000000000000000000000000000000000018000
-C0000000000001FFFFFFFFF000000000000000000000000000000000000000000000000000018000
-C0000000000000020000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-C0000000000000000000000000000000000000000000000000000000000000000000000000018000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000000000000000000000000000
-473 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-12 fz
-2 F /|______Times-Roman fnt
-0.15495 0.(Protections...)ashow
-485 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01272 0.(This will display, and then set the default protections for all selected sequences. If two or more of the)ashow
-496 90 gm
--0.02812 0.(sequences differ in their current protection settings, a warning message will appear in the protection dialog)ashow
-507 90 gm
--0.00859 0.(box. The protections currently available are alignment gap protection, ambiguous character protection,)ashow
-518 90 gm
--0.02893 0.(unambiguous character protection, and translation protection.)ashow
-0 0 gm
-(nc 520 270 600 352 6 rc)kp
-64 gr
-521 271 599 351 1 rc
-0 gr
-T 80 39.75726 271 521 28 210 105 T 1 db
-00000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000400000000000000000000000000000000000000000000C000
-C000000400000000000000000000000000000000000000000000C000
-C000000400000000000000000000000000030000000000000000C000
-C0003F840000000003C00201F000040000430000000000000000C000
-C0002004000000000660060198000C0000C00000000000000000C000
-C0001004000000000603CF819B679F3C3DF31E1B0F8000000000C000
-C000100400000000070666019B6CCC6666C3331D980000000000C000
-C00008040000000003C66601938CCC6660C333199C0000000000C000
-C00008040000000000E7E601E30CCC7E60C333198F0000000000C000
-C00000040000000000660601830CCC6060C33319838000000000C000
-C00000040000000006662601830CCC6262C33319818000000000C000
-C00000040000000003C3C3818307873C3C731E199F0000000000C000
-C000000400000000000000000000000000000000000000000000C000
-C001FFF800000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF8C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000200000000000000000000000000000000000000C000
-C0001F0000000100000000000000000000000000000000000000C000
-C000108000000100000000000000000000000000000000000000C000
-C00010430B0E0080000000000000000000000000000000000000C000
-C00010448C910080000000000000000000000000000000000000C000
-C000104848910080000000000000000000000000000000000000C000
-C0001048489F0080000000000000000000000000000000000000C000
-C000104848900080000000000000000000000000000000000000C000
-C000108488910080000000000000000000000000000000000000C000
-C0001F03088E0080000000000000000000000000000000000000C000
-C000000000000100000000000000000000000000000000000000C000
-C000000000000100000000000000000000000000000000000000C000
-C000000000000200000000000000000000000000000000000000C000
-C008000000000400000000000000000000000000000000000000C000
-C006000000001800000000000000000000000000000000000000C000
-C001FFFFFFFFE000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C0000C600000000C0000000630E6000003000000000000000000C000
-C0060C600000000C000000063186000043000000000000000000C000
-C0060C600000000C0000000601800000C0000000000000000000C000
-C00B0C63C606787C06CC3C3E33E63C79F31E1B0F980000000000C000
-C00B0C666666CCCC07766666318666CCC3331D98180000000000C000
-C0130C66636CCCCC066666663186600CC333199C000000000000C000
-C01F8C66636CFCCC066666663186607CC333198F000000000000C000
-C0318C6663FCC0CC06666666318660CCC3331983800000000000C000
-C0318C666198C4DC0666666E318662CCC3331981980000000000C000
-C0318C63C198786C06663C3631863C76731E199F180000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000040000000000008080000000000020000000000000000000C000
-C000040000000000008080000000000020000000100000000000C000
-C000040000000000008000000000000020000000100000000000C000
-C00004000445870B30B08F110C2238072C38B383BCE2CE000000C000
-C00004000446488CC8C89111122240083244C444111310000000C000
-C000040004444088888891112122401022048048111210000000C000
-C0000400044447888888911121223010223C83C811F20C000000C000
-C000040004444888888893112122081022448448110202000000C000
-C000040004C4488888888D131226080822448444111202000000C000
-C00004000344474888F0810D0C1A7007223A83A38CE21C000000C000
-C000040000000000000001000000000000000000000000000000C000
-C03FFC000000000000000E000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-T 80 39 271 560.75726 28 210 103 T 1 db
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000040000000080800000000000200000000000000000000000C000
-C000040000000080800000000000200000001000000000000000C000
-C000040000000080000000000000200000001000000000000000C000
-C0000400070B30B08F110C2238072C38B383BCE2CE0000000000C000
-C0000400088CC8C89111122240083244C4441113100000000000C000
-C000040000888888911121224010220480481112100000000000C000
-C000040007888888911121223010223C83C811F20C0000000000C000
-C000040008888888931121220810224484481102020000000000C000
-C0000400088888888D1312260808224484441112020000000000C000
-C0000400074888F0810D0C1A7007223A83A38CE21C0000000000C000
-C000040000000000010000000000000000000000000000000000C000
-C03FFC00000000000E0000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000010000000000000000000000000000000000000000000000C000
-C000060000000000000000000000000000000000000000000000C000
-C0000C0000088000000000000000000000000000000000000000C000
-C000180000088000000000020000000000000000000000000000C000
-C000300000080000000000020000000000000000000000000000C000
-C00C740007088F161661C2C781E3858700000000000000000000C000
-C01EE40008889119199223220224464800000000000000000000C000
-C03FE40000889111111222220220444800000000000000000000C000
-C01FC400078891111113E2220223C44600000000000000000000C000
-C00FC40008889311111202220264444100000000000000000000C000
-C007840008888D111112222201A4444100000000000000000000C000
-C0038400074881111111C2218023A78E00000000000000000000C000
-C001040000000100000000000020040000000000000000000000C000
-C03FFC0000000E000000000001C0040000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000010000000000000000000000000000000000000000000000C000
-C000060000000000000000000000000000000000000000000000C000
-C0000C0000000000080008000000000000000000000000000000C000
-C000180004000000080108000000000000000000000000000000C000
-C000300004000000080100000000000000000000000000000000C000
-C00C74000F59C2C388E3C86161C0000000000000000000000000C000
-C01EE40004622324091108919200000000000000000000000000C000
-C03FE40004402224081109091200000000000000000000000000C000
-C01FC4000441E22308F109091180000000000000000000000000C000
-C00FC40004422220891109091040000000000000000000000000C000
-C007840004422220891108911040000000000000000000000000C000
-C00384000341D22708E8C8611380000000000000000000000000C000
-C001040000000000000000000000000000000000000000000000C000
-C03FFC0000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-C000000000000000000000000000000000000000000000000000C000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000
-00000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000
-00000000000000000000000000000000000000000000000000000000
-621 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-12 fz
-2 F /|______Times-Roman fnt
-1.17477 0. 32 0.11747 0.(Get info...)awidthshow
-633 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01683 0.(This option allows the viewing and setting of attributes associated with each individual sequence. These)ashow
-644 90 gm
--0.00477 0.(attributes include short name, full name, description, author, comments, and the sequence type. The)ashow
-655 90 gm
--0.03654 0.(attributes loosely correspond to fields in a Genbank entry. Comments can be included for each sequence in)ashow
-666 90 gm
--0.00778 0.(the comments field.)ashow
-F T cp
-%%Page: ? 9
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 303 gm
-12 fz
-2 F /|______Times-Roman fnt
-(9)show
-0 0 gm
-(nc 72 162 251 419 6 rc)kp
-64 gr
-73 163 250 418 1 rc
-0 gr
-T 255 11.87997 163 73 74 579 27 T 1 db
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000400000000000000000000000000000000000000000000000000000000000000000000003800000000018000000000000000000000000000000000000000000000000000006000
-C0003F8400000000000000000000000000000000000000000000000003C00000000000000018006000000000218000000000000000000000000000000000000000000000000000006000
-C000200400000000000000000000000000000000000000000000000006600000000000000018006000000000600000000000000000000000000000000000000000000000000000006000
-C00010040000000000000000000000000000000000000000000000000603C3E331E1B0F1E018D8F9E366CC3CF98F0D800000000000000000000000000000000000000000000000006000
-C0001004000000000000000000000000000000000000000000000000070666633331D99B3018EC633367766661998EC00000000000000000000000000000000000000000000000006000
-C000080400000000000000000000000000000000000000000000000003C66663333199833018CC633386660661998CC00000000000000000000000000000000000000000000000006000
-C000080400000000000000000000000000000000000000000000000000E7E66333F19983F018CC633306663E61998CC00000000000000000000000000000000000000000000000006000
-C000000400000000000000000000000000000000000000000000000000660663330199830018CC633306666661998CC00000000000000000000000000000000000000000000000006000
-C0000004000000000000000000000000000000000000000000000000066626E37311998B1018CC633306666661998CC00000000000000000000000000000000000000000000000006000
-C000000400000000000000000000000000000000000000000000000003C3C361B1E198F1E018CC61E306663B398F0CC00000000000000000000000000000000000000000000000006000
-C000000400000000000000000000000000000000000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C001FFF800000000000000000000000000000000000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC6000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-T 255 11 163 84.87997 74 579 25 T 1 db
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC6000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000078210200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000084220200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000102240100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000102280100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000102380100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000102240100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000102220100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000084210100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000078210100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C008000000800000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C006000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C001FFFFFC000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-T 255 11 163 95.87997 74 579 25 T 1 db
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001FFFFFFFFFF80000000000080000000000020000000000000000080006000
-C000180000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C01E18000020000000000000208823C3C7C10861E00000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C033180000600000000000003188242224218861100000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C0301B0F1BF81B0F0D9878003184480224118891100000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C0381D999B601D998EECCC002A84480224114891100000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C01E19999C6019818CCCCC002A828803C4116891E00000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C00719999860198F8CCCFC0024810802441129F9100000000000000000000000003FC00000000000F084300180F8210C00003FBE427F00802083078840200F0F0787F7C4420080006000
-C0031999986019998CCCC0002481080224111909100000000000000000000000000600000000000088C430018084310C0000042042080080318308088020088888408404620080006000
-C0331999986019998CCCC4002081042224211909140000000000000000000000000618CD878C000088C44801808231120000042024080080318488090020088890208404620080006000
-C01E198F1838198ECCCC7800208103C227C10909EA0000000000000000000000000618CECCCC000088A448018082291200000420140800802A848C0A0020088890208404520080006000
-C0000000000000000000000000000000000000001500000000000000000000000006188CCCC00000F0B4480180822D120000043C180800802A84870E0020088F102087845A0080006000
-C0000000000000000000000000000000000000002A800000000000000000000000060D8CCFC000009094FC018082253F0000042028080080248FC18900200F09102084044A0080006000
-C00000000000000000000000000000000000000015000000000000000000000100060D0CCC000000888C8401808223210000042024080080248840888020080890208404460080006000
-C000000000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0006070CCC4C0000888C8401808423210000042042080080208840884020080888408404460080006000
-C0000000000000000000000000000000000000000400000000000000000000000006060F878C00008884840180F821210000043E4208008020884F0840200808878087C4420080006000
-C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000
-C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000
-T 255 11 163 106.87997 74 579 25 T 1 db
-C000000000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0006070CCC4C0000888C8401808423210000042042080080208840884020080888408404460080006000
-C0000000000000000000000000000000000000000400000000000000000000000006060F878C00008884840180F821210000043E4208008020884F0840200808878087C4420080006000
-C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000
-C00000000000000000000000000000000000000000000000000000000000000000000C0C0000000000000001800000000000000000000080000000000020000000000000000080006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000001800000000000000000000080000000000020000000000000000080006000
-C00000000000000000000000000000000000000000000000000000000000000000000000000000FFFFFFFFFF80000000001FFFFFFFFFFFBFFFFFFFFFFFEFFFFFFFFFFFFFFFFF80006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0000018C0000000000000000000000010000000001000000202002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C01F8018C0000000000000082000000010000000001000000202002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0180018C00000000000000C6000000010000000001000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183318C06C3C3661E0000C6221C61611C38B30E0162218B2C22C2380000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183318C076663BB330000AA222091912240CC910192224C322322400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C01F3318C06606333330000AA224109110240888101122428222222400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183318C0663E3333F000092144109111E30888F01114428222222300000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-T 255 11 163 117.87997 74 579 25 T 1 db
-C0183318C06C3C3661E0000C6221C61611C38B30E0162218B2C22C2380000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183318C076663BB330000AA222091912240CC910192224C322322400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C01F3318C06606333330000AA224109110240888101122428222222400000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183318C0663E3333F000092144109111E30888F01114428222222300000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183318C0666633330000092144109112208889101114428222222080000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0183718C0666633331000082082091112208889101108248222222080000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C0181B18C0663B3331E000082081C61E11D70888E81108188222222700000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000100001000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000300001000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000004000000000000000000000000000000000000000006000
-C0000000000000000000001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018F80388000003000000000020878FC7830180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018CC0388000003000000000031884808448280000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C602C8CC6CC361E360000031804800484480000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C602C8CC7763B3336000002A804F80484880000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-T 255 11 163 128.87997 74 579 25 T 1 db
-C018F80388000003000000000020878FC7830180000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018CC0388000003000000000031884808448280000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C602C8CC6CC361E360000031804800484480000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C602C8CC7763B3336000002A804F80484880000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C602E8CC666333338000002A838043885080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C60268CC666333F300000024804040485FC0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018C60238CC6663330300000024804040484080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018CC0238DC6663331300000020884848448080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C018F802186C6663E1E300000020878787830080000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000006000
-C00000000000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000003000060000000000200000040400400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C01F0000000030008600000008202000000404004000C00000000000400000000000000007C1086000000000000000000000000000000000000000000000000000000000000000006000
-C019800000000001800000000C602000000400000000C0000000000040000000000000000421886000000000000000000000000000000000000000000000000000000000000000006000
-T 255 11 163 139.87997 74 579 25 T 1 db
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000003000060000000000200000040400400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C01F0000000030008600000008202000000404004000C00000000000400000000000000007C1086000000000000000000000000000000000000000000000000000000000000000006000
-C019800000000001800000000C602000000400000000C0000000000040000000000000000421886000000000000000000000000000000000000000000000000000000000000000006000
-C018C787C79B31B3E63C36000C602C443165845847012002CE161C38F038E1E22385839C0411889000000000000000000000000000000000000000000000000000000000000000006000
-C018CCCC0CDB31D986663B000AA0324449864464480120031119224440411222244644220411489000000000000000000000000000000000000000000000000000000000000000006000
-C018CCCE0C1C3199866633000AA0224485044444480123FA1111220440411222244448220411689000000000000000000000000000000000000000000000000000000000000000006000
-C018CFC78C1831998666330009202228850444444603F0021F113E3C4031F22227C4483E041129F800000000000000000000000000000000000000000000000000000000000000006000
-C018CC01CC183199866633000920222885044444410210021011204440090222240448200411190800000000000000000000000000000000000000000000000000000000000000006000
-C0198C40CC583199866633000822221049044444410210021111224440091262644444220421190900000000000000000000000000000000000000000000000000000000000000006000
-C01F078F879831F0E63C330008222210310444444E0210020E1E1C3A3070E1A1A384439C07C1090900000000000000000000000000000000000000000000000000000000000000006000
-C000000000000180000000000000002000000000000000000010000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000180000000000000006000000000000000000010000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000040000000000000000000000000000000000000006000
-C000000000000000000000001FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFC0000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000030000000000000000080000000000000000000220000000000040000000000000004000000000000080000000000000000000000000000000000000000000000000000006000
-T 255 11 163 150.84613 74 579 26 T 1 db
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000030000000000000000080000000000000000000220000000000040000000000000004000000000000080000000000000000000000000000000000000000000000000000006000
-C00600043000000000007F00008000104030001E000000220781080040440000420F00000004041002002000080104030000000000000000000000000000000000000000000000006000
-C006000C300000000000080000800018C030001000000022044108004040000044100000000406300200200008018C030000000000000000000000000000000000000000000000006000
-C00B0CDF361E36000000083888862C18C048001038B59C2204410800444471C048100038583C0630722C78C38B018C048000000000000000000000000000000000000000000000006000
-C00B0CCC3B33360000000844888930154048001044C6222204410800444482205018004464440550823221240C8154048000000000000000000000000000000000000000000000006000
-C0130CCC33333800000008048890A0154048001E44842222078090002A848220700E00044444055102222214088154048000000000000000000000000000000000000000000000006000
-C01F8CCC333330000000083C5090A01240FC00107C843E22048090002A8463E04803003C44440491022222130881240FC000000000000000000000000000000000000000000000006000
-C0318CCC33333000000008445090A0124084001040842022044090002A841200440100444444049102222210888124084000000000000000000000000000000000000000000000006000
-C0318DCC3333300000000844208921104484901044842222444861201104122442812044444C041082222120889104484800000000000000000000000000000000000000000000006000
-C03186C7331E30000000083A208621104484901038841C22444861201104E1C4429E203A44340410722218C7089104484800000000000000000000000000000000000000000000006000
-C000000000000000000000004000020000002000000000008000004000000008000000000000000000000000002000000000000000000000000000000000000000000000000000006000
-C00000000000000000000000C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000006000
-C00000000000000000007FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-T 255 11 163 161.87997 74 579 25 T 1 db
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000000000000000000000000000000000000000000008000000804001000000000000000E000000000000000000000000000000000000000000002000206000
-C4010BE448463C707800000006000000000004001E1889E0E7C00000000002100800000080400100003844300000020000000000E1070E00380000000000000000000000002000206000
-C401120448492248800000000600000000000400202489112400000000000330080000008000000000246430000002000000000123089100440000000000000000000000002000206000
-C40122044B50A2448000000009002C7161C38F802042891204000000000003300B111C2CB1C2C707802264480001C20E2C380162050881000400000000000000000000000023FFE06000
-C40142028B50A244C000000009003089922444003042891204000000000002D00C912230C843210800225448000202113244019201088100040000000000000000000000002000006000
-C401C3C28B50BC4470000000093E2089122044001C4289E207800000000002D0089122208842210800225448000402112244011201088200180000000000000000000000002000006000
-C40122010490A444180000001F8020F913E3C4000642892204000000000002D0088A22208842210700224CFC00040211227C011221088400040000000000000000000000002000006000
-C40112010490A244080000001080208112044400024289120400000000000210088A22208842210080224C84000402112240011221088800040000000000000000000000002000206000
-C4010A010489224808000000108020891224440C022489110400000000000213088422208842210080244484600202112244011121089018446000000000000000000000002000206000
-C4010BE104862270F000000010802071E1C3A38C3C187110E7C000000000021308841C208842210F003844846001C20E223801E0E1071F18386000000000000000000000002000206000
-C400000000000000000000000000000100000000000000000000000000000000000800000000000000000000C00000000000010000000000000000000000000000000000002000206000
-T 255 11 163 172.87997 74 579 25 T 1 db
-C40112010490A244080000001080208112044400024289120400000000000210088A22208842210080224C84000402112240011221088800040000000000000000000000002000206000
-C4010A010489224808000000108020891224440C022489110400000000000213088422208842210080244484600202112244011121089018446000000000000000000000002000206000
-C4010BE104862270F000000010802071E1C3A38C3C187110E7C000000000021308841C208842210F003844846001C20E223801E0E1071F18386000000000000000000000002000206000
-C400000000000000000000000000000100000000000000000000000000000000000800000000000000000000C00000000000010000000000000000000000000000000000002000206000
-C400000000000000000000000000000100000000000000000000000000000000001800000000000000000000000000000000010000000000000000000000000000000000002018206000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000203C206000
-C4000000000000000000000000000080000000000000000000000000100000000000000020000000000000000387020000000000000000000001C000000000000000000000207E206000
-C400000000000000000000001E00008000000008000001E0000400001000000FE000000020000200000000840081020000200000000840000000400000000000000000000020FF206000
-C4000000000000000000000011000080000000080000011000040000000000010000000000000200000000CC0081000000200000000CC0000000400000000000000000000020FF206000
-C4000000000000000000000011163888E164471F1C300111C1CF8E167070C00107161C2CE07227C70F1800CCE0810E07227C70F1800CD10E38B041C3CA8E1E3000000000002000206000
-C40000000000000000000000111844911184488822300112220411181088C0010899223020822208901800B51081020822208901800B511044C842240F91203000000000002000206000
-C40000000000000000000000111044A011044888020001E024041110100800010891222021022208900000B51081021022208900000B5120448840240A81200000000000002000206000
-C400000000000000000000001E1044E0F10288881E000111E4041F10107800010F913E202102220F8E0000B5108102102220F8E0000B4A20448841E38A8F1C0000000000002000206000
-C400000000000000000000001010449111028888220001122404101010880001081120202102220801000085108102102220801000084A20448842204A91020000000000002000206000
-C40000000000000000000000101044891101088822300112220411101088C001089122202082620881180085108102082620881180084410448842204A91023000000000002000206000
-C4000000000000000000000010103884E90107071D3001E1D1C38E101074C00107111C202071A1C71E180084E08102071A1C71E18008440E38F041D78A8EBC3000000000002000206000
-C400000000000000000000000000000000020000006000000000000000018000000000000000000000300000000000000000000300000800008000000000006000000000002000206000
-C400000000000000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000001800008000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000003800000000001C00000000000000007000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000001080000000800000002000400000002100000001000000004000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000001980000000800000002000400000003300000001000000004000000000000000000000000000000000000000000000000000000000000000002000206000
-C4000000000000000000000019A21C71608387951C7C7041C3C600334438E2C1070F2A38F8E0E3870E000000000000000000000000000000000000000000000000000000002000206000
-C4000000000000000000000016A220899084481F222088422406002D4441132108903E444111044891000000000000000000000000000000000000000000000000000000002000206000
-C4000000000000000000000016A2408910804815022008422400002D4481122100902A044012044091000000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000169440891083C7151E207843E380002D28811221078E2A3C40F207C79F000000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000109440891084409522208842004000212881122108812A444112040890000000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000108820891084409522208842204600211041122108812A444111044891180000000000000000000000000000000000000000000000000000002000206000
-C4000000000000000000000010881C71E083AF151D1C7441C78600211038E3C1075E2A3A38E8E3874E180000000000000000000000000000000000000000000000000000002000206000
-T 255 11 163 183.87997 74 579 25 T 1 db
-C40000000000000000000000169440891083C7151E207843E380002D28811221078E2A3C40F207C79F000000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000109440891084409522208842004000212881122108812A444112040890000000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000108820891084409522208842204600211041122108812A444111044891180000000000000000000000000000000000000000000000000000002000206000
-C4000000000000000000000010881C71E083AF151D1C7441C78600211038E3C1075E2A3A38E8E3874E180000000000000000000000000000000000000000000000000000002000206000
-C40000000000000000000000001000010000000000000000000C0000200002000000000000000000000000000000000000000000000000000000000000000000000000000023FFE06000
-C400000000000000000000000030000100000000000000000000000060000200000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000001900000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C401E3E3CF9E3E4439F0000004000021000000000010008000020E1C10000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C401120208112064490000000C00002100000000003000800006112210000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C401120208112064810000001400004161C3C70F005001F1C00A1122080000000000000000000000000000000000000000000000000000000000000000000000000000000020FF206000
-C4011202081120548100000004000041922408900010008220021122080000000000000000000000000000000000000000000000000000000000000000000000000000000020FF206000
-C401E3C3CF1E3C5481E0000004000041102408900010008220020F220800000000000000000000000000000000000000000000000000000000000000000000000000000000207E206000
-C40122020812204C810000000400004111E38F8E00100082200201220800000000000000000000000000000000000000000000000000000000000000000000000000000000203C206000
-C40112020811204C810000000400004112204801001000822002012208000000000000000000000000000000000000000000000000000000000000000000000000000000002018206000
-C401120208112044410000000400002112204881001000822002112210000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C40113E20F913E4439F0000004000021E1D7871E00100071C0020E1C10000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000001800000000000000000000000060000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C4000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000023FFE06000
-C400000000000000000000000000100000000000020000000000000000000000000002003840010000000000000002000004200000000400000000800804000001000000002000006000
-C400000FEFBF907C000000001E001040000004000200E110C00000000000000000000200404001000000000000000200000420000000041000000082080400004100000000201C006000
-C40000010204104000000000110000400000040002009190C00000000000000000000200400000000000000000000000000400000000001000000002080000004100000000201C006000
-C40000010204104000000000111C70F8E1638F8E1E00899120078E1E447160E387801E38F9C2C70B0F003C7161C54E07003CE111C2C79C3E44011387CB1C2C00F961C00000201C006000
-C400000102041040000000001122104111844411220089512008112244899104480022444043210C910044899227C2080044211223080410440150820C8432004192200000201C006000
-C400000102041078000000001E2210411100441122008951200811224489120448002244404221089100448912254210004421122208041044015082088422004112200000201C006000
-C40000010204104000000000123E1041F103C41F22008933F0071F2244F91207C700227C40422108910044F912254210004420A3E207041028015082088422004113E00000201C006000
-C400000102041040000000001120104101044410220089321000902244811204008022404042210893004C8112254210004420A2020084102800A082088422004112000000201C006000
-C40000010204104000000000112210411104441126009112100091264C89110440802644404221088D00348912254208004C2042220084101000A082088422004112200000201C006000
-T 255 11 163 194.87997 74 579 25 T 1 db
-C400000102041078000000001E2210411100441122008951200811224489120448002244404221089100448912254210004421122208041044015082088422004112200000201C006000
-C40000010204104000000000123E1041F103C41F22008933F0071F2244F91207C700227C40422108910044F912254210004420A3E207041028015082088422004113E00000201C006000
-C400000102041040000000001120104101044410220089321000902244811204008022404042210893004C8112254210004420A2020084102800A082088422004112000000201C006000
-C40000010204104000000000112210411104441126009112100091264C89110440802644404221088D00348912254208004C2042220084101000A082088422004112200000201C006000
-C40000010F841E7C00000000111C1038E103A38E1A00E112100F0E1A347110E38F001A38404221088100047111C5420700342041C20F040E1000A081C88422003911C00000201C006000
-C40000000000000000000000000000000000000000000000000000020000000000000000000000000100040000000000000000000000000020000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000020000000000000000000000000E00380000000000000000000000000060000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000004000000000000003800000000080000008040010000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000004000001080000000800000000080000008040010000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000001980000000800000000080000008000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000000F2C3839C1C3C019A21C71608387951C00B111C2CB1C2C70780000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000001032444042240016A220899084481F2200C912230C843210800000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000001022448042240016A2408910804815020089122208842210800000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000000E227C8043E380169440891083C7151E0088A22208842210700000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000012240804200401094408910844095220088A22208842210080000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000012244404220401088208910844095220088422208842210080000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000001E3C383841C78010881C71E083AF151D008841C208842210F00000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000002000000000000010000100000000000000800000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000002000000000000030000100000000000001800000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000070000001000000402003800000000000000000000000180000001800000000000000000000000000000000000000000000000000000000201C006000
-C4000007C3113C443080000010801000021100000040200080000E000070E3E0071F1C002041C3870400000000000000000000000000000000000000000000000000000000201C006000
-C4000001049122643080000019801000033000000040000080001100008912000881220020C224488400000000000000000000000000000000000000000000000000000000201C006000
-C40000010851226448800000199C10000337038B1C58E0E0800001000081020008010200414224488200000000000000000000000000000000000000000000000000000000201C006000
-C4000001085122544880000016A2100002D1040C2264211080000100008103C008020200404224488200000000000000000000000000000000000000000000000000000000201C006000
-C400000108513C544880000016A2100002D10808224421108000020000F1E027CF0404004041E3870200000000000000000000000000000000000000000000000000000000201C006000
-C40000010851244CFC80000016A2100002D1080822442110800004000089102008840800404024488200000000000000000000000000000000000000000000000000000000201C006000
-C40000010851224C8480000010A210000211080822442110800008000089102008881000404024488200000000000000000000000000000000000000000000000000000000201C006000
-T 255 11 163 205.87997 74 579 25 T 1 db
-C4000001085122544880000016A2100002D1040C2264211080000100008103C008020200404224488200000000000000000000000000000000000000000000000000000000201C006000
-C400000108513C544880000016A2100002D10808224421108000020000F1E027CF0404004041E3870200000000000000000000000000000000000000000000000000000000201C006000
-C40000010851244CFC80000016A2100002D1080822442110800004000089102008840800404024488200000000000000000000000000000000000000000000000000000000201C006000
-C40000010851224C8480000010A210000211080822442110800008000089102008881000404024488200000000000000000000000000000000000000000000000000000000201C006000
-C4000001049122448480000010A2106002110408224421108300100C0089122008882000204224488400000000000000000000000000000000000000000000000000000000201C006000
-C400000E030E224484F00000109C1060021103881C7820E083001F0C0070E1C007083E002041C3870400000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000180000000000000000180000001800000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C4000000000000000000000000080001C0000000001C3800000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C4000003DFC6227031E38000000800004000000800204000000004000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000040206324831124000000000004000000800204000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000402093244491220000F3854B041C0079F1C7CF80163889C1C4400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000602092A444912200010087CC84220080822204001844884225400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000382092A4449E22000100854884220080802204001044884225400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C4000000C21FA644FD2220000E08548843E007081E20400107C5043E5400000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000004210A64485122000010854884200008822204001040504202800000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000004210A24885124000010854884220008822204001044204222800000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000078210A270851380001E0854F041C00F071D2040010382041C2800000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000000000008000000000000003F8000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000800000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C401E0C3CF800E188917F0000000000001C7C000000000000107000000000000070E000000000000021C004000000000000000000000000000000000000000000000000000201C006000
-C40110C40800122489908000000000000220400000000000030880000000000008910000000000000622004000000000000000000000000000000000000000000000000000201C006000
-C40111240800204289908000000000000220400E000000000508000E000000000091003C000000000A2200F800000000000000000000000000000000000000000000000000201C006000
-C40111260800204289508000000000000220801100000000010800100000000000910044000000001222004000000000000000000000000000000000000000000000000000201C006000
-C401E1238F002042895080000000000001C1000100000000010F002000000000030E004400000000221E004000000000000000000000000000000000000000000000000000201C006000
-C40113F0C800204289308000000000000221000F00000000010880200000000000910044000000003F02004000000000000000000000000000000000000000000000000000201C006000
-T 255 11 163 216.87997 74 579 25 T 1 db
-C40111240800204289908000000000000220400E000000000508000E000000000091003C000000000A2200F800000000000000000000000000000000000000000000000000201C006000
-C40111260800204289508000000000000220801100000000010800100000000000910044000000001222004000000000000000000000000000000000000000000000000000201C006000
-C401E1238F002042895080000000000001C1000100000000010F002000000000030E004400000000221E004000000000000000000000000000000000000000000000000000201C006000
-C40113F0C800204289308000000000000221000F00000000010880200000000000910044000000003F02004000000000000000000000000000000000000000000000000000201C006000
-C4011210480020428930800000000000022200110000000001088020000000000091004C000000000202004000000000000000000000000000000000000000000000000000201C006000
-C40112104800102489108000000000000222001100000000010880100000000008910034000000000222004000000000000000000000000000000000000000000000000000201C006000
-C401E2178F800E18711080000000000001C2000E800000000107000E00000000070E000400000000021C003800000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000004000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000038000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40A00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C41500000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C42A80000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C41500000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40A00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-T 255 11 163 227.87997 74 579 25 T 1 db
-C40400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-T 255 12 163 238.92306 74 579 26 T 1 db
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C40000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000201C006000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000006000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000006000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000002000206000
-C7FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE3FFE06000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-C000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000006000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000
-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFE000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-285 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-14 fz
-2 F /|______Times-Roman fnt
-0.53985 0. 32 0.05398 0.( Edit menu)awidthshow
-308 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.29429 0.(Select All)ashow
-320 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03724 0.(Selects all sequences. This is helpful when you have several dozen sequences.)ashow
-342 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-0.19332 0. 32 0.01933 0.(Select by name...)awidthshow
-354 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.02021 0.(Select all sequences containing a given string in their short names field. No wild cards are allowed, and only)ashow
-365 90 gm
--0.01213 0.(selecting is allowed, not de-selecting. The search is started when the Return key is pressed, and multiple)ashow
-376 90 gm
--0.06175 0.(searches can be accumulated. Press Done when finished.)ashow
-398 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.08575 0.(Cut/Copy/Paste sequences)ashow
-410 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.05426 0.(Cut copy and paste are primarily useful for reordering sequences, and for making duplicate copies of a given)ashow
-421 90 gm
-0.07507 0. 32 0.00750 0.(sequence. They do not pass information to other programs. This capability will be implemented in a later)awidthshow
-432 90 gm
--0.04278 0.(release. Cut and copy will place the selected sequences on an internal clipboard. They can then be pasted)ashow
-443 90 gm
--0.06423 0.(back into the top of editing window \(default\) or under the last selected sequence.)ashow
-465 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-0.02943 0.(Group/Ungroup)ashow
-477 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.00544 0.(Assign a group number to the selected sequences. Edit operations in any one sequence within the group will)ashow
-488 90 gm
-0.00320 0. 32 0.00032 0.(be propagated to all within the group. Sequence protections from one group are also imposed upon all other)awidthshow
-499 90 gm
-0.07339 0. 32 0.00733 0.(sequence in the given group. If a given operation is illegal in one sequence in a group \(i.e. alignment)awidthshow
-510 90 gm
-0.06820 0. 32 0.00682 0.(modification\) then it will not work in any of the sequences in that group. Ungroup will remove the selected)awidthshow
-521 90 gm
--0.05171 0.(sequences from a given group.)ashow
-543 90 gm
-12 fz
-2 F /|______Times-Roman fnt
-(Compress)show
-555 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01747 0.(Compress will remove gap characters from the selected sequences. The user has the option of removing all)ashow
-566 90 gm
-0.34576 0. 32 0.03457 0.(gaps, or simply all columns containing nothing but gaps. This is useful for minimizing the length of a)awidthshow
-577 90 gm
-0.05169 0.(subalignment.)ashow
-599 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.10784 0.(Reverse Sequence)ashow
-611 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.06991 0.(Reverses the selected sequences. Alignment gaps are reversed as well. The selected sequences will remain)ashow
-622 90 gm
--0.13101 0.(aligned after reversal.)ashow
-647 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.04180 0. 32 0.00418 0.( DNA/RNA menu)awidthshow
-671 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.16490 0.(Complement Sequence)ashow
-683 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.20431 0. 32 0.02043 0.(Converts DNA/RNA into its complement strand \(keeping full IUPAC ambiguity\). This function has no)awidthshow
-694 90 gm
--0.01968 0.(effect on text, protein, or mask sequence. Note that this function does not produce the reverse strand of DNA)ashow
-705 90 gm
--0.02952 0.(but merely converts A<->T and G<->C. If the reverse strand is needed, remember to Complement and)ashow
-716 90 gm
--0.09683 0.(Reverse the sequence \(Edit menu\).)ashow
-F T cp
-%%Page: ? 10
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(10)show
-107 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.68984 0. 32 0.06898 0.(External Functions)awidthshow
-130 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.02468 0.(See appendix C for a full description of functions supported in GDE 2.0 All external functions are described)ashow
-141 90 gm
-0.00610 0. 32 0.00061 0.(in the configuration file .GDEmenus. Here is a brief description of some of the basic functions included.)awidthshow
-163 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.16563 0.(File menu)ashow
-186 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.07015 0.(New Sequence )ashow
-186 198 gm
--0.05102 0.(Create a new sequence. Prompts for sequence type, and short name.)ashow
-208 90 gm
--0.03674 0.(Import foreign format)ashow
-219 90 gm
--0.03681 0.(Export foreign format)ashow
-219 198 gm
--0.08541 0.(Load and save sequences using Readseq by Don Gilbert \(see Appendix C\).)ashow
-241 90 gm
--0.01116 0.(Save Selection)ashow
-241 198 gm
--0.08074 0.(Save the currently selected sequences in a specified file.)ashow
-263 90 gm
-0.35308 0. 32 0.03530 0.(Print Selection)awidthshow
-263 198 gm
-0.01174 0. 32 0.00117 0.(Print the selected sequences to the chosen printer. This function supports)awidthshow
-274 198 gm
-0.04150 0. 32 0.00415 0.(the Unix command enscript as well as lpr. The .GDEmenus file may need to)awidthshow
-285 198 gm
--0.00283 0.(be modified to add the names of local printers to the printer list.)ashow
-307 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.20724 0.(Edit menu)ashow
-330 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.25080 0.(sort...)ashow
-330 198 gm
--0.06867 0.(Sort the selected sequences by a primary and secondary key. Pass the new order)ashow
-341 198 gm
--0.00726 0.(to a new GDE window.)ashow
-363 90 gm
--0.14492 0.(Extract)ashow
-363 198 gm
--0.07679 0.(Extract the selected sequences into a new window.)ashow
-385 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.24058 0.(DNA/RNA Menu)ashow
-397 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.14962 0.(Translate)ashow
-397 198 gm
--0.05361 0.(Translate the selected sequences from DNA/RNA to Amino acid. The user can)ashow
-408 198 gm
--0.07470 0.(specify the desired reading frame, and the minimum open reading frame \(stop)ashow
-419 198 gm
--0.00601 0.(codon to stop codon\) to translate. The user can also choose between single)ashow
-430 198 gm
--0.09318 0.(letter code and triple letter codes.)ashow
-452 90 gm
-0.55633 0. 32 0.05563 0.(Dot plot)awidthshow
-452 198 gm
--0.02882 0.(Display a dotplot identity matrix for the selected sequence\(s\). If only one)ashow
-463 198 gm
-(sequence is selected, then the dotplot is a self comparison. If two or more)show
-474 198 gm
--0.10966 0.(sequences are selected, then the first two sequences are compared.)ashow
-496 90 gm
-0.63247 0. 32 0.06324 0.(Clustal Align)awidthshow
-496 198 gm
-0.04074 0. 32 0.00407 0.(Align the selected sequences using the clustalv algorithm by Des Higgins.)awidthshow
-507 198 gm
--0.07983 0.(\(See Appendix C\))ashow
-529 90 gm
-0.29251 0. 32 0.02925 0.(Find All )awidthshow
-529 198 gm
--0.04464 0.(Search and highlight the selected sequences for a given substring. A specified)ashow
-540 198 gm
--0.02334 0.(percent of mismatching can also be allowed.)ashow
-562 90 gm
-0.15136 0. 32 0.01513 0.(Variable Positions)awidthshow
-562 198 gm
--0.06744 0.(The selected sequences are scored column by column for conservation. The)ashow
-573 198 gm
-0.02929 0. 32 0.00292 0.(result is returned as a grey scale alignment color mask. This can be useful)awidthshow
-584 198 gm
-0.41549 0. 32 0.04154 0.(in selecting PCR primers.)awidthshow
-606 90 gm
--0.09349 0.(Sequence Consensus)ashow
-606 198 gm
--0.02246 0.(Return the consensus for the selected sequences. This can either be a majority)ashow
-617 198 gm
-0.17730 0. 32 0.01773 0.(consensus, or an ambiguity consensus using IUPAC coding.)awidthshow
-639 90 gm
--0.01284 0.(Distance Matrix )ashow
-639 198 gm
--0.07553 0.(Calculate a distance matrix for the selected sequences. \(See Appendix C\))ashow
-661 90 gm
-(MFOLD)show
-661 198 gm
--0.01577 0.(Fold the selected sequences using MFOLD by Michael Zuker. The resulting)ashow
-672 198 gm
--0.08619 0.(structure is returned as a nested bracket \('[]'\) representation of the secondary)ashow
-683 198 gm
--0.05360 0.(structure.\(See appendix C.\))ashow
-705 90 gm
--0.13284 0.(Draw Secondary Structure)ashow
-705 198 gm
--0.07971 0.(Draw the selected sequence using the proposed secondary structure. Both the)ashow
-716 198 gm
--0.11421 0.(secondary structure prediction, and the RNA sequence should be selected before)ashow
-F T cp
-%%Page: ? 11
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(11)show
-81 198 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.08117 0. 32 0.00811 0.(calling this function. The drawing program is LoopTool. \(See Appendix C\))awidthshow
-103 90 gm
-0.39718 0. 32 0.03971 0.(Highlight Helix)awidthshow
-103 198 gm
--0.02478 0.(Show all violations to a proposed RNA secondary structure. The secondary)ashow
-114 198 gm
--0.06376 0.(structure represented must be selected, as well as the aligned sequences to be)ashow
-125 198 gm
--0.06709 0.(tested. The selected sequences will then be colored according to whether or not)ashow
-136 198 gm
--0.02209 0.(they support the proposed 2)ashow
-currentfont SwToSym
--0.02209 0.(\260)ashow
-setfont
--0.02209 0.( structure. Standard Watson/Crick paring will be)ashow
-147 198 gm
-(colored dark blue, G-U paring will be colored light blue, mismatches will be)show
-158 198 gm
--0.03656 0.(colored gold, and pairng to gaps will be red.)ashow
-180 90 gm
--0.09217 0.(Blastn/BlastX)ashow
-180 198 gm
--0.06690 0.(Search the selected sequence \(select only one\) against a given database with the)ashow
-191 198 gm
-0.21972 0. 32 0.02197 0.(BLAST searching tool written by Altschul, Gish, Miller, Myers, and Lipman.)awidthshow
-202 198 gm
--0.05590 0.(Blastn searches DNA against DNA databases, blastx searches DNA against AA)ashow
-213 198 gm
--0.04621 0.(databases by translating the sequence in all six reading frames. \(See Appendix C\))ashow
-235 90 gm
-0.02897 0.(FastA)ashow
-235 198 gm
--0.06472 0.(Search the selected sequence \(select only one\) against a given database using the)ashow
-246 198 gm
-0.02075 0. 32 0.00207 0.(FASTA similarity search program written by Pearson and Lipman. \(See)awidthshow
-257 198 gm
--0.09335 0.(Appendix C\))ashow
-279 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.15008 0.(Protein Menu)ashow
-313 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.63247 0. 32 0.06324 0.(Clustal Align)awidthshow
-313 198 gm
--0.02090 0.(Align the selected amino acid sequences using the clustal algorithm. \(See)ashow
-324 198 gm
--0.09335 0.(Appendix C\))ashow
-346 90 gm
-0.21408 0. 32 0.02140 0.(Blastp, Tblastn, Blast3)awidthshow
-346 198 gm
--0.06690 0.(Search the selected sequence \(select only one\) against a given database with the)ashow
-357 198 gm
-0.21972 0. 32 0.02197 0.(BLAST searching tool written by Altschul, Gish, Miller, Myers, and Lipman.)awidthshow
-368 198 gm
--0.04742 0.(Blastp searches AA against AA databases, tblastn searches AA against DNA)ashow
-379 198 gm
--0.03672 0.(databases by translating the database in all six reading frames. Blast3 finds)ashow
-390 198 gm
-0.00274 0. 32 0.00027 0.(three way alignments that are could not be found with only pairwise comparisons.)awidthshow
-401 198 gm
--0.07983 0.(\(See Appendix C\))ashow
-423 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.20037 0.(Sequence Management Menu)ashow
-446 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.07385 0. 32 0.00738 0.(Assemble contigs)awidthshow
-446 198 gm
-0.02410 0. 32 0.00241 0.(Assemble the selected sequences into contigs using the program CAP \(Contig)awidthshow
-457 198 gm
--0.03036 0.(Assemble Program\) written by Xiaoqiu Huang. The resulting sequences are)ashow
-468 198 gm
--0.03370 0.(returned to the current GDE window, and they are grouped into contigs. The)ashow
-479 198 gm
--0.05517 0.(user can then sort the sequences by group, and offset to produce an ordered list of)ashow
-490 198 gm
-0.02960 0. 32 0.00296 0.(the contigs. \(See Appendix C\))awidthshow
-512 90 gm
--0.02136 0.(Strategy view)ashow
-512 198 gm
-0.03570 0. 32 0.00357 0.(Pass out the selected sequences to StratView. This program will display contigs)awidthshow
-523 198 gm
--0.01431 0.(in a greatly reduced line drawing. This is very useful for large contigs.)ashow
-545 90 gm
-0.32684 0. 32 0.03268 0.(Restriction sites)awidthshow
-545 198 gm
--0.06761 0.(Search the selected sequences for the restriction enzymes specified in the given)ashow
-556 198 gm
--0.01243 0.(enzyme file. The restriction sites are then colored by enzyme.)ashow
-578 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.07624 0.(Phylogeny menu)ashow
-602 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.07130 0.(DeSoete Tree fit)ashow
-602 198 gm
--0.00927 0.(Calculate a phylogenetic tree using a least squares fitting algorithm on a distance)ashow
-613 198 gm
--0.06059 0.(matrix calculated from the selected sequences. The results can then be passed on)ashow
-624 198 gm
--0.01338 0.(to treetool for display and manipulation. \(See Appendix C\))ashow
-646 90 gm
-0.99151 0. 32 0.09915 0.(Phylip 3.4)awidthshow
-646 198 gm
-0.10299 0. 32 0.01029 0.(Pass the selected data to on of the treeing programs in Phylip, written by)awidthshow
-657 198 gm
-0.16418 0. 32 0.01641 0.(Joe Felsenstein. The chosen phylip program is started in it's own window,)awidthshow
-668 198 gm
--0.12712 0.(with the selected sequences already loaded. \(See Appendix C\))ashow
-F T cp
-%%Page: ? 12
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(12)show
-106 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.70434 0. 32 0.07043 0.(Citation of work)awidthshow
-129 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.03417 0. 32 0.00341 0.(We ask that any published work using any of the external functions in GDE cite the appropriate authors.)awidthshow
-140 90 gm
--0.08705 0.(Please see Appendix C for references.)ashow
-187 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.42251 0. 32 0.04225 0.(Bug reports/extensions)awidthshow
-210 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03602 0.(Any bug reports, RFE's \(request for enhancement\), and useful extensions to the GDE should be forwarded by)ashow
-221 90 gm
-0.06652 0. 32 0.00665 0.(electronic mail to:)awidthshow
-243 90 gm
--0.12284 0.(smith@nucleus.harvard.edu)ashow
-265 90 gm
--0.01402 0.(Please include as much detail as possible in bug reports so that the bug can be reproduced.)ashow
-276 90 gm
--0.16358 0.(Correspondence should be addressed to:)ashow
-298 90 gm
-0.66253 0. 32 0.06625 0.(Steven Smith)awidthshow
-309 90 gm
-0.03417 0. 32 0.00341 0.(Director of Computation)awidthshow
-320 90 gm
--0.16851 0.(Harvard Genome Laboratory)ashow
-331 90 gm
-0.55831 0. 32 0.05583 0.(16. Divinity Ave.)awidthshow
-342 90 gm
--0.04499 0.(Cambridge, MA)ashow
-342 162 gm
-(02138)show
-433 90 gm
-14 fz
-2 F /|______Times-Roman fnt
--0.06921 0.(Acknowledgments)ashow
-456 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01979 0.(I would like to thank the following people for their input and assistance and code used in the development of)ashow
-467 90 gm
-(the GDE:)show
-489 90 gm
-0.10726 0. 32 0.01072 0.(Carl Woese, Gary Olsen and Mike Maciukenas at University of Illinois Dept of Microbiology, Ross)awidthshow
-500 90 gm
--0.02450 0.(Overbeek at Argonne National Laboratories,Walter Gilbert, Patrick Gillevet, Chunwei Wang and Susan)ashow
-511 90 gm
-0.02166 0. 32 0.00216 0.(Russo at the Harvard Genome Laboratory. I would also like to personally thank the following people for)awidthshow
-522 90 gm
-0.02990 0. 32 0.00299 0.(their permission to include their software with this release of GDE.)awidthshow
-544 90 gm
-0.14419 0. 32 0.01441 0.(Des Higgins)awidthshow
-555 90 gm
--0.04928 0.(David Lipman and the group at NCBI)ashow
-566 90 gm
-0.03280 0. 32 0.00328 0.(William Pearson)awidthshow
-577 90 gm
-(Don Gilbert)show
-588 90 gm
--0.11433 0.(Xiaoqui Huang)ashow
-599 90 gm
-0.07690 0. 32 0.00769 0.(Joe Felsenstein)awidthshow
-610 90 gm
--0.09466 0.(Michael Zuker)ashow
-621 90 gm
--0.13116 0.(Geert DeSoete)ashow
-632 90 gm
--0.01974 0.(Michael Maciukenas and the group at the Ribosomal Database Project)ashow
-654 90 gm
-0.10925 0. 32 0.01092 0.(It is only by the generosity of these people that GDE has been successful.)awidthshow
-F T cp
-%%Page: ? 13
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(13)show
-95 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.57128 0. 32 0.05712 0.(Appendix A, File Formats)awidthshow
-122 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.03565 0.(The currently supported file formats include GDE data files, Genbank formatted files \(with type extensions\),)ashow
-133 90 gm
--0.01033 0.(a generic flat file format, and a color mask file.)ashow
-155 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.18190 0.(GDE format)ashow
-167 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.02778 0.(GDE format is a tagged field format used for storing all available information about a sequence. The format)ashow
-178 90 gm
--0.03959 0.(matches very closely the GDE internal structures for sequence data. The format consists of text records)ashow
-189 90 gm
--0.08013 0.(starting and ending with braces \('{}'\). Between the open and close braces are several tagged field lines)ashow
-200 90 gm
--0.04377 0.(specifying different pieces of information about a given sequence. The tag values can be wrapped with)ashow
-211 90 gm
--0.05966 0.(double quote characters \('""'\) as needed. If quotes are not used, the first whitespace delimited string is taken)ashow
-222 90 gm
--0.03451 0.(as the value. The allowable fields are:)ashow
-244 90 gm
-({)show
-255 90 gm
--0.21841 0.(name)ashow
-255 162 gm
--0.09494 0.("Short name for sequence")ashow
-266 90 gm
--0.06198 0.(longname)ashow
-266 162 gm
--0.11402 0.("Long \(more descriptive\) name for sequence")ashow
-277 90 gm
--0.35173 0.(sequence-ID)ashow
-277 162 gm
--0.09922 0.("Unique ID number")ashow
-288 90 gm
--0.26521 0.(creation-date)ashow
-288 162 gm
-0.12008 0. 32 0.01200 0.("mm/dd/yy hh:mm:ss")awidthshow
-299 90 gm
--0.19244 0.(direction)ashow
-299 162 gm
--0.19648 0.([-1|1])ashow
-310 90 gm
--0.28077 0.(strandedness)ashow
-310 162 gm
--0.16368 0.([1|2])ashow
-321 90 gm
--0.07225 0.(type)ashow
-321 162 gm
--0.07638 0.([DNA|RNA||PROTEIN|TEXT|MASK])ashow
-332 90 gm
--0.15226 0.(offset)ashow
-332 162 gm
--0.03222 0.(\(-999999,999999\))ashow
-343 90 gm
--0.17175 0.(group-ID)ashow
-343 162 gm
--0.02587 0.(\(0,999\))ashow
-354 90 gm
--0.29151 0.(creator)ashow
-354 162 gm
--0.02342 0.("Author's name")ashow
-365 90 gm
--0.31198 0.(descrip)ashow
-365 162 gm
--0.12005 0.("Verbose description")ashow
-376 90 gm
--0.01441 0.(comments)ashow
-376 162 gm
--0.01306 0.("Lines of comments that can be fairly arbitrary)ashow
-387 90 gm
--0.03907 0.(text about a sequence. Return characters are allowed, but no internal)ashow
-398 90 gm
--0.05203 0.(double quotes or brace characters. Remember to close with a double)ashow
-409 90 gm
--0.25929 0.(quote")ashow
-420 90 gm
--0.37757 0.(sequence)ashow
-420 162 gm
--0.11505 0.("gctagctagctagctagctcttagctgtagtcgtagctgatgctagct)ashow
-431 90 gm
--0.13807 0.(gatgctagctagctagctagctgatcgatgctagctgatcgtagctgacg)ashow
-442 90 gm
--0.09281 0.(gactgatgctagctagctagctagctgtctagtgtcgtagtgcttattgc")ashow
-453 90 gm
-(})show
-475 90 gm
--0.03117 0.(Any fields that are not specified are assumed to be the default values. Offsets can be negative as well as)ashow
-486 90 gm
--0.00729 0.(positive. Genbank entries written out in this format will have all \("\) converted to \('\), and all \({}\) converted)ashow
-497 90 gm
--0.03678 0.(to \([]\) to avoid confusion in the parser. Leading and trailing gaps are removed prior to writing each sequence.)ashow
-508 90 gm
--0.00801 0.(This format is deliberately verbose in order to be simple to duplicate.)ashow
-552 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.11645 0.(Genbank format:)ashow
-564 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.06373 0.(GDE can read a concatenated list of Genbank entries, and extract certain fields from such files. The default)ashow
-575 90 gm
-(method for storing nucleic acid, amino acid, masking sequences or text is in Genbank format. The following)show
-586 90 gm
--0.19308 0.(fields are recognized:)ashow
-608 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.23880 0.(LOCUS:)ashow
-608 162 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.04878 0.(Short name for this sequence \(Maximum of 32 characters\))ashow
-0 -3 rm
-7 fz
-2 F /|______Times-Roman fnt
-(\240)show
-619 90 gm
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
--0.21890 0.(DEFINITION:)ashow
-619 162 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.06732 0.(Definition of sequence \(Maximum of 80 characters\))ashow
-630 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.22387 0.(ORGANISM:)ashow
-630 198 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-(Full name of organism \(Maximum of 80 characters\))show
-641 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.22743 0.(AUTHORS:)ashow
-641 198 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.04580 0.(Authors of this sequence \(Maximum of 80 characters\))ashow
-652 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.22111 0.(ACCESSION:)ashow
-652 162 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.06069 0.(ID Number for this sequence \(Maximum of 80 characters\))ashow
-663 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.23217 0.(ORIGIN:)ashow
-663 162 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.16001 0.(Beginning of sequence data)ashow
-0 -3 rm
-7 fz
-2 F /|______Times-Roman fnt
-(\240)show
--4096 -4096 gm
--4095 -4095 0 gr
-lin
-6 25 lw
-691 90 gm
-691 233 lin
-25 6 lw
-1 1 lw
-704 90 gm
-0 gr
-T 1 setTxMode
-9 fz
-2 F /|______Times-Roman fnt
--0.03189 0.(\240 Required field)ashow
-F T cp
-%%Page: ? 14
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(14)show
-81 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.39801 0.(//)ashow
-81 198 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.22740 0.(End of sequence data)ashow
-0 -3 rm
-7 fz
-2 F /|______Times-Roman fnt
-(\240)show
-103 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.01617 0. 32 0.00161 0.(All other lines are retained as comments. The LOCUS line also specifies what type of sequence follows.)awidthshow
-114 90 gm
-0.31143 0. 32 0.03114 0.(The form of this line is:)awidthshow
-133 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(LOCUS )ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.26533 0.(name)ashow
-133 198 gm
--0.19900 0.(size)ashow
-0 fs
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
--0.29850 0.( bp)ashow
-133 234 gm
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.26533 0.(type)ashow
-133 270 gm
--0.26533 0.(date)ashow
-155 90 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.23757 0. 32 0.02375 0.(where )awidthshow
-2 fs
-{}mark T /Times-Italic /|______Times-Italic 0 rf
-2 F /|______Times-Italic fnt
-0.07641 0.(name)ashow
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-2 F /|______Times-Roman fnt
-0.19012 0. 32 0.01901 0.( is the Genbank Locus name, )awidthshow
-2 fs
-{}mark T /Times-Italic /|______Times-Italic 0 rf
-2 F /|______Times-Italic fnt
-0.16464 0. 32 0.01646 0.(size )awidthshow
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-2 F /|______Times-Roman fnt
-0.17791 0. 32 0.01779 0.(is total base count, )awidthshow
-2 fs
-{}mark T /Times-Italic /|______Times-Italic 0 rf
-2 F /|______Times-Italic fnt
-0.05877 0.(type)ashow
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-2 F /|______Times-Roman fnt
-0.21957 0. 32 0.02195 0.( is one of DNA, RNA, PROTEIN,)awidthshow
-166 90 gm
--0.03018 0.(MASK, or TEXT and )ashow
-2 fs
-{}mark T /Times-Italic /|______Times-Italic 0 rf
-2 F /|______Times-Italic fnt
--0.02607 0.(date)ashow
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-2 F /|______Times-Roman fnt
--0.02537 0.( is of the form dd-MON-yyyy. In this way, the standard Genbank format is)ashow
-177 90 gm
--0.06455 0.(extended to store all text, mask and protein data. The Genbank character set has also been extended in order)ashow
-188 90 gm
--0.04171 0.(to support these other data types. Valid characters are:)ashow
-210 90 gm
--0.04614 0.(DNA/RNA:)ashow
-210 198 gm
--0.00355 0.(Full IUPAC coding as well as '-' and '~' characters for alignment)ashow
-221 198 gm
--0.10925 0.(gaps)ashow
-232 90 gm
-0.04852 0.(Protein:)ashow
-232 198 gm
--0.01260 0.(All valid single letter codes plus '-' and '~'. Other ASCII characters)ashow
-243 198 gm
--0.04739 0.(may be inserted, however external functions may be confused by)ashow
-254 198 gm
--0.12287 0.(such characters.)ashow
-265 90 gm
-(Mask:)show
-265 198 gm
-0.01281 0. 32 0.00128 0.(All legal printable ASCII characters. If used as a selection mask, all)awidthshow
-276 198 gm
-0.12207 0. 32 0.01220 0.(columns containing a '0' will be removed from any analysis.)awidthshow
-287 90 gm
--0.02584 0.(Text:)ashow
-287 198 gm
--0.05348 0.(All valid ASCII characters.)ashow
-309 90 gm
-0.05142 0. 32 0.00514 0.(Here is a valid Genbank entry for two E.coli tRNA's:)awidthshow
-328 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.20202 0.(LOCUS ECOTRNT4 76 bp RNA 28-JAN-1991)ashow
-336 90 gm
--0.20275 0.(DEFINITION E. coli \(T4 infected\) vulnerable tRNA \(A\).)ashow
-344 90 gm
--0.20637 0.( ORGANISM Escherichia coli)ashow
-352 90 gm
--0.20315 0.( AUTHORS Amitsur,M., Levitz,R. and Kaufmann,G.)ashow
-360 90 gm
--0.20362 0.(FEATURES From To/Span Description)ashow
-368 90 gm
--0.20298 0.( tRNA 1 76 vulnerable tRNA\(A\))ashow
-376 90 gm
--0.21559 0.(BASE COUNT ?)ashow
-384 90 gm
--0.23880 0.(ORIGIN)ashow
-392 90 gm
--0.20169 0.( 1 GGGUCGUUAG CUCAGUUGGU AGAGCAGUUG ACUUUUAAUC AAUUGGNCGC AGGUUCGAAU)ashow
-400 90 gm
--0.20666 0.( 61 CCUGCACGAC CCACCA)ashow
-408 90 gm
--0.39801 0.(//)ashow
-416 90 gm
--0.20202 0.(LOCUS ECOTRQ1 75 bp RNA 28-JAN-1991)ashow
-424 90 gm
--0.20587 0.(DEFINITION E.coli Gln-tRNA-1.)ashow
-432 90 gm
--0.20637 0.( ORGANISM Escherichia coli)ashow
-440 90 gm
--0.20503 0.( AUTHORS Yaniv,M. and Folk,W.R.)ashow
-448 90 gm
--0.20166 0.(SOURCE -REFERENCE [1] JOURNAL J. Biol. Chem. 250, 3243-3253 \(1975\))ashow
-456 90 gm
--0.20362 0.(FEATURES From To/Span Description)ashow
-464 90 gm
--0.20269 0.( tRNA 1 75 Gln-tRNA-1 \(NAR: 0510\))ashow
-472 90 gm
--0.20231 0.( refnumbr 1 1 sequence not numbered in [1])ashow
-480 90 gm
--0.21559 0.(BASE COUNT ?)ashow
-488 90 gm
--0.23880 0.(ORIGIN)ashow
-496 90 gm
--0.20169 0.( 1 UGGGGUAUCG CCAAGCGGUA AGGCACCGGU UUUUGAUACC GGCAUUCCCU GGUUCGAAUC)ashow
-504 90 gm
--0.20697 0.( 61 CAGGUACCCC AGCCA)ashow
-512 90 gm
--0.39801 0.(//)ashow
-545 90 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-12 fz
-2 F /|______Times-Roman fnt
--0.18539 0.(Flat file format:)ashow
-557 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.11169 0. 32 0.01116 0.(This is a simplified format for importing sequence data, and passing it out to analysis functions. Very little)awidthshow
-568 90 gm
-0.02944 0. 32 0.00294 0.(information is actually retained in this format, and should be used carefully so as not to lose attribute)awidthshow
-579 90 gm
-0.03372 0. 32 0.00337 0.(information. It is defined as follow:)awidthshow
-598 90 gm
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-7 fz
-2 F /|______Courier-Oblique fnt
--0.20729 0.(type_character short_name)ashow
-606 90 gm
--0.21559 0.(sequence_data)ashow
-614 90 gm
--0.21559 0.(sequence_data)ashow
-622 90 gm
--0.21559 0.(sequence_data)ashow
-630 90 gm
--0.29850 0.(...)ashow
-652 90 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.02508 0.(The type character is # for DNA/RNA, % for protein sequence, @ for mask sequence, and " for text. The)ashow
-663 90 gm
-0.07781 0. 32 0.00778 0.(short name is the same as the LOCUS line in Genbank. This is followed by lines of sequence, each ending)awidthshow
-674 90 gm
--0.03877 0.(with a return character.These lines are read until the next type character is encountered, or until the end of the)ashow
-685 90 gm
--0.01963 0.(file is reached. Care should be taken in using this format with text as space characters are stripped)ashow
--4096 -4096 gm
--4095 -4095 0 gr
-lin
-6 25 lw
-703 90 gm
-703 233 lin
-25 6 lw
-1 1 lw
-F T cp
-%%Page: ? 15
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(15)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.03921 0. 32 0.00392 0.(automatically. As of release 2.0, flat file format allows for an optional offset to be specified in parentheses)awidthshow
-92 90 gm
--0.07716 0.(after the sequence name. An offset represents how many leading gap characters should be placed before the)ashow
-103 90 gm
-0.07568 0. 32 0.00756 0.(start of a sequence. If this offset does not exist, then it is defined to be 0.)awidthshow
-125 90 gm
-0.13809 0. 32 0.01380 0.(Here is a sample flat file for two Ecoli tRNA's:)awidthshow
-144 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.22387 0.(#ECOTRNT4)ashow
-152 90 gm
--0.20237 0.(GGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGNCGCAGGUUCGAAU)ashow
-160 90 gm
--0.21226 0.(CCUGCACGACCCACCA)ashow
-168 90 gm
--0.22743 0.(#ECOTRQ1)ashow
-176 90 gm
--0.20237 0.(UGGGGUAUCGCCAAGCGGUAAGGCACCGGUUUUUGAUACCGGCAUUCCCUGGUUCGAAUC)ashow
-184 90 gm
--0.21322 0.(CAGGUACCCCAGCCA)ashow
-217 90 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-12 fz
-2 F /|______Times-Roman fnt
--0.09919 0.(Color mask:)ashow
-229 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.10299 0. 32 0.01029 0.(The format for a color mask has been kept simple to make implementation of color functions easy. The)awidthshow
-240 90 gm
-0.05355 0. 32 0.00535 0.(format optionally defines which sequence to color, whether or not to color alignment gaps in the existing)awidthshow
-251 90 gm
-0.04089 0. 32 0.00408 0.(sequence, and how long the following mask will be. It is then followed by a list of decimal color codes)awidthshow
-262 90 gm
--0.01760 0.(\(range 0 to 15\) for each position in the sequence. There are four keywords used in the color mask file.)ashow
-273 90 gm
--0.12745 0.(Those keywords are:)ashow
-295 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(name:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.22111 0.(short name)ashow
-295 234 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.09985 0.(If short name matches a currently loaded sequence,)ashow
-306 234 gm
-0.16754 0. 32 0.01675 0.(then impose this color mask on that sequence. If this)awidthshow
-317 234 gm
-0.04577 0. 32 0.00457 0.(line is omitted, then color all sequences this color, and the color)awidthshow
-328 234 gm
-0.10223 0. 32 0.01022 0.(mask is expected to start at the leftmost column on the screen.)awidthshow
-350 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(length:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.23880 0.(length)ashow
-350 234 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.40191 0. 32 0.04019 0.(The following list in length long)awidthshow
-372 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.23217 0.(nodash:)ashow
-372 234 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.00579 0. 32 0.00057 0.(Skip over dash characters when imposing this color mask)awidthshow
-383 234 gm
--0.03414 0.(on the named sequence. This allows an unaligned color)ashow
-394 234 gm
--0.09637 0.(mask to be placed over aligned sequence.)ashow
-416 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.23880 0.(start:)ashow
-416 234 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.02685 0. 32 0.00268 0.(Begin reading the color mask on the next line.)awidthshow
-438 90 gm
-0.04302 0. 32 0.00430 0.(Here is a sample color mask file:)awidthshow
-457 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.21070 0.(name:test_sequence)ashow
-465 90 gm
--0.22387 0.(length:10)ashow
-473 90 gm
--0.23217 0.(nodash:)ashow
-481 90 gm
--0.23880 0.(start:)ashow
-489 90 gm
-(3)show
-497 90 gm
-(3)show
-505 90 gm
-(3)show
-513 90 gm
-(6)show
-521 90 gm
-(5)show
-529 90 gm
-(3)show
-537 90 gm
-(3)show
-545 90 gm
-(3)show
-553 90 gm
-(2)show
-561 90 gm
-(7)show
-580 90 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.00993 0.(The colors in the default color lookup table are:)ashow
-591 90 gm
-(0)show
-591 126 gm
--0.10839 0.(White)ashow
-591 270 gm
-(8)show
-591 306 gm
--0.33126 0.(Black)ashow
-602 90 gm
-(1)show
-602 126 gm
--0.08668 0.(Yellow)ashow
-602 234 gm
-(9)show
-602 270 gm
--0.09704 0.(Grey 1)ashow
-613 90 gm
-(2)show
-613 126 gm
-(Violet)show
-613 270 gm
-(10)show
-613 306 gm
--0.09704 0.(Grey 2)ashow
-624 90 gm
-(3)show
-624 126 gm
--0.55415 0.(Red)ashow
-624 270 gm
-(11)show
-624 306 gm
--0.09704 0.(Grey 3)ashow
-635 90 gm
-(4)show
-635 126 gm
--0.55255 0.(Aqua)ashow
-635 270 gm
-(12)show
-635 306 gm
--0.09704 0.(Grey 4)ashow
-646 90 gm
-(5)show
-646 126 gm
--0.11416 0.(Lime Green)ashow
-646 270 gm
-(13)show
-646 306 gm
--0.09704 0.(Grey 5)ashow
-657 90 gm
-(6)show
-657 126 gm
--0.29557 0.(Blue)ashow
-657 270 gm
-(14)show
-657 306 gm
--0.09704 0.(Grey 6)ashow
-668 90 gm
-(7)show
-668 126 gm
--0.02070 0.(Purple)ashow
-668 270 gm
-(15)show
-668 306 gm
--0.10839 0.(White)ashow
-F T cp
-%%Page: ? 16
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(16)show
-84 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.21636 0. 32 0.02163 0.(Appendix B, Adding Functions)awidthshow
-107 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.04040 0.(The GDE uses a menu description language to define what external programs it can call, and what parameters)ashow
-118 90 gm
-0.08483 0. 32 0.00848 0.(and data to pass to each function. This language allows users to customize their own environment to suite)awidthshow
-129 90 gm
--0.14483 0.(individual needs.)ashow
-151 90 gm
--0.02262 0.(The following is how the GDE handles external programs when selected from a menu:)ashow
-0 0 gm
-(nc 164 126 255 369 6 rc)kp
-64 gr
-164 211 202 277 14.5 14.5 4 rr
-0 gr
-164.5 211.5 201.5 276.5 14.5 14.5 0 rr
-64 gr
-164 126 202 192 14.5 14.5 4 rr
-0 gr
-164.5 126.5 201.5 191.5 14.5 14.5 0 rr
-64 gr
-164 300 202 366 14.5 14.5 4 rr
-0 gr
-164.5 300.5 201.5 365.5 14.5 14.5 0 rr
-183 192 gm
-(nc 164 126 255 208 6 rc)kp
-183 211 lin
-(nc 164 126 255 369 6 rc)kp
-177 205 190 218 165 195 4 ar
-183 277 gm
-(nc 164 126 255 296 6 rc)kp
-183 300 lin
-(nc 164 126 255 369 6 rc)kp
-177 293 190 307 165 195 4 ar
-145 385 91 243 th
-177 133 gm
-0 gr
-T 1 setTxMode
-12 fz
-2 F /|______Times-Roman fnt
--0.17835 0.(Display dialog)ashow
-185 133 gm
--0.07539 0.(box presenting)ashow
-192 133 gm
-0.30838 0. 32 0.03083 0.(user options.)awidthshow
-177 215 gm
--0.19335 0.(Write out selected)ashow
-185 215 gm
--0.13066 0.(data \(if any\) to)ashow
-192 215 gm
--0.06405 0.(temporary files.)ashow
-177 303 gm
--0.20286 0.(Call external )ashow
-185 303 gm
-(function, passing)show
-192 303 gm
--0.10202 0.(parameters and data.)ashow
-tu
-64 gr
-214 300 255 366 4 rc
-0 gr
-214.5 300.5 254.5 365.5 0 rc
-202 331 gm
-(nc 164 126 211 369 6 rc)kp
-214 331 lin
-(nc 164 126 255 369 6 rc)kp
-208 325 221 338 255 285 4 ar
-ts
-224 307 gm
-0 gr
-T 1 setTxMode
--0.15270 0.(External program)ashow
-232 307 gm
-0.09719 0. 32 0.00971 0.(runs analysis, and)awidthshow
-239 307 gm
--0.06079 0.(writes results to)ashow
-247 307 gm
--0.06405 0.(temporary files.)ashow
-tu
-64 gr
-217 211 255 277 14.5 14.5 4 rr
-0 gr
-217.5 211.5 254.5 276.5 14.5 14.5 0 rr
-236 300 gm
-(nc 164 281 255 369 6 rc)kp
-236 277 lin
-(nc 164 126 255 369 6 rc)kp
-230 271 243 284 345 375 4 ar
-ts
-227 218 gm
-0 gr
-T 1 setTxMode
--0.08067 0.(GDE reads results)ashow
-235 218 gm
--0.11495 0.(of temporary files)ashow
-242 218 gm
-0.20019 0. 32 0.02001 0.(\(if any\).)awidthshow
-tu
-64 gr
-217 126 255 192 14.5 14.5 4 rr
-0 gr
-217.5 126.5 254.5 191.5 14.5 14.5 0 rr
-236 211 gm
-(nc 164 195 255 369 6 rc)kp
-236 192 lin
-(nc 164 126 255 369 6 rc)kp
-230 186 243 199 345 375 4 ar
-ts
-227 133 gm
-0 gr
-T 1 setTxMode
--0.13632 0.(GDE cleans up)ashow
-235 133 gm
--0.06405 0.(temporary files,)ashow
-242 133 gm
--0.04287 0.(and displays new)ashow
-250 133 gm
-(data.)show
-tu
-275 90 gm
-(nc 31 30 761 582 6 rc)kp
-10 fz
-2 F /|______Times-Roman fnt
-0.03387 0. 32 0.00338 0.(Each step in this process is described in a file .GDEmenus in the user's current or home)awidthshow
-286 90 gm
--0.17651 0.(directory.)ashow
-308 90 gm
--0.02418 0.(The language used in this file describes three phases to an external function call. The first phase describes)ashow
-319 90 gm
-0.12283 0. 32 0.01228 0.(the menu item as it will appear, and the Unix command line that is actually run when it is selected. The)awidthshow
-330 90 gm
--0.06280 0.(second phase describes how to prompt for the parameters needed by the function. The third phase describes)ashow
-341 90 gm
--0.05538 0.(what data needs to be passed as input to the external function, and what data \(if any\) needs to be read back)ashow
-352 90 gm
-0.58975 0. 32 0.05897 0.(from its output.)awidthshow
-374 90 gm
--0.01350 0.(The form of the language is a simple keyword/value list delimited by the colon \(:\) character. The language)ashow
-385 90 gm
-0.13610 0. 32 0.01361 0.(retains old values until new ones are set. For example, setting the menu name is done once for all items in)awidthshow
-396 90 gm
-0.02822 0. 32 0.00282 0.(that menu, and is only reset when the next menu is reached.)awidthshow
-418 90 gm
--0.09211 0.(The keywords for phase one are:)ashow
-440 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(menu:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.22387 0.(menu name)ashow
-440 306 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.06471 0.(Name of current menu)ashow
-451 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(item:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.22387 0.(item name)ashow
-451 306 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.02093 0.(Name of current menu item)ashow
-462 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(itemmeta:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.22743 0.(meta_key)ashow
-462 306 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.12283 0.(Meta key equivalence \(quick keys\))ashow
-473 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(itemhelp:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.22387 0.(help_file)ashow
-473 306 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.15548 0. 32 0.01554 0.(Help file \(either full path, or in)awidthshow
-484 306 gm
--0.09056 0.(GDE_HELP_DIR\))ashow
-492 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(itemmethod:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21710 0.(Unix command)ashow
-514 90 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.14251 0. 32 0.01425 0.(The item method command is a bit more involved, it is the Unix command that will actually run the)awidthshow
-525 90 gm
-0.02655 0. 32 0.00265 0.(external program intended. It is one line long, and can be up to 256 characters in length. It can have)awidthshow
-536 90 gm
--0.02996 0.(embedded variable names \(starting with a '$'\) that will be replaced with appropriate values later on. It can)ashow
-547 90 gm
--0.00277 0.(consist of multiple Unix commands separated by semi-colons \(;\), and may contain shell scripts and)ashow
-558 90 gm
-0.00350 0. 32 0.00035 0.(background processes as well as simple command names. Examples will be given later.)awidthshow
-580 90 gm
--0.07740 0.(The keywords for phase two are:)ashow
-602 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(arg:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.20848 0.(argument_variable_name)ashow
-602 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.07934 0. 32 0.00793 0.(Name of this variable. It will appear)awidthshow
-613 342 gm
-0.09628 0. 32 0.00962 0.(in the itemmethod: line with a dollar)awidthshow
-624 342 gm
-0.35354 0. 32 0.03535 0.(sign \($\) in front of it.)awidthshow
-635 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(argtype:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.20503 0.(slider,chooser,choice_menu or text)ashow
-635 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.02027 0.(The type of graphic object)ashow
-646 342 gm
--0.00474 0.(representing this argument.)ashow
-668 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(arglabel:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21144 0.(descriptive label)ashow
-668 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.07995 0. 32 0.00799 0.(A short description of what this)awidthshow
-679 342 gm
--0.09936 0.(argument represents)ashow
-701 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(argmin:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.20805 0.(minimum_value \(integer\))ashow
-701 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.11270 0.(Used for sliders.)ashow
-723 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(argmax:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.20805 0.(maximum_value \(integer\))ashow
-723 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.11270 0.(Used for sliders.)ashow
-F T cp
-%%Page: ? 17
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(17)show
-92 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(argvalue:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.20805 0.(default_value \(integer\))ashow
-92 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.00714 0.(It is the numeric value associated with)ashow
-103 342 gm
--0.05737 0.(sliders or the default choice in)ashow
-114 342 gm
--0.06477 0.(choosers and choice_menus \(the first)ashow
-125 342 gm
-0.10726 0. 32 0.01072 0.(choice is 0, the second is 1 etc.\))awidthshow
-147 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(argtext:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21559 0.(default value)ashow
-147 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.07046 0.(Used for text fields.)ashow
-169 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(argchoice:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.19900 0.(displayed value)ashow
-0 fs
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
--0.19900 0.(:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21710 0.(passed value)ashow
-169 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.15618 0.(Used for choosers and)ashow
-180 342 gm
-0.10101 0. 32 0.01010 0.(choice_menus. The first value is)awidthshow
-191 342 gm
--0.12577 0.(displayed on screen, and the second)ashow
-202 342 gm
--0.00753 0.(value is passed to the itemmethod)ashow
-213 342 gm
-0.12620 0.(line.)ashow
-235 90 gm
--0.06112 0.(The keywords for phase three are as follows:)ashow
-257 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(in:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.19900 0.(input_file)ashow
-0 fs
-{}mark T /Courier /|______Courier 0 rf
-2 F /|______Courier fnt
-( )show
-257 342 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.07873 0. 32 0.00787 0.(GDE will replace this name with a)awidthshow
-268 342 gm
--0.12794 0.(randomly generated temporary file)ashow
-279 342 gm
-(name. It will then write the selected)show
-290 342 gm
-0.24902 0. 32 0.02490 0.(data out to this file.)awidthshow
-312 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(informat:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21890 0.(file_format)ashow
-312 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.14724 0. 32 0.01472 0.(Write data to this file for input to)awidthshow
-323 342 gm
-0.33538 0. 32 0.03353 0.(this function. Currently support)awidthshow
-334 342 gm
--0.05738 0.(values are Genbank, and flat.)ashow
-345 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.23217 0.(inmask:)ashow
-345 342 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.05563 0.(This data can be controlled by a)ashow
-356 342 gm
-0.14770 0. 32 0.01477 0.(selection mask.)awidthshow
-378 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.23217 0.(insave:)ashow
-378 342 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.08697 0. 32 0.00869 0.(Do not remove this file after running)awidthshow
-389 342 gm
-0.19424 0. 32 0.01942 0.(the external function. This is useful)awidthshow
-400 342 gm
-0.01831 0. 32 0.00183 0.(for functions put in the background.)awidthshow
-422 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(out:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21890 0.(output_file)ashow
-422 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.07873 0. 32 0.00787 0.(GDE will replace this name with a)awidthshow
-433 342 gm
--0.12794 0.(randomly generated temporary file)ashow
-444 342 gm
-0.21469 0. 32 0.02146 0.(name. It is up to the external function)awidthshow
-455 342 gm
-0.36849 0. 32 0.03684 0.(to fill this file with any results that)awidthshow
-466 342 gm
-0.03570 0. 32 0.00357 0.(might be read back into the GDE.)awidthshow
-488 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.19900 0.(outformat:)ashow
-2 fs
-{}mark T /Courier-Oblique /|______Courier-Oblique 0 rf
-2 F /|______Courier-Oblique fnt
--0.21890 0.(file_format)ashow
-488 342 gm
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.18402 0. 32 0.01840 0.(The data in the output file will be in)awidthshow
-499 342 gm
-0.29846 0. 32 0.02984 0.(this format. Currently support)awidthshow
-510 342 gm
--0.05863 0.(values are colormask, Genbank, and)ashow
-521 342 gm
-0.04431 0.(flat.)ashow
-543 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.22743 0.(outsave:)ashow
-543 342 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.01464 0.(Do not remove this file after reading.)ashow
-554 342 gm
-0.03158 0. 32 0.00315 0.(This is useful for background tasks.)awidthshow
-576 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.21559 0.(outoverwrite:)ashow
-576 342 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.06021 0.(Overwrite existing sequences in the current)ashow
-587 342 gm
--0.00816 0.(GDE window. Currently supported with)ashow
-598 342 gm
--0.03097 0.("gde" format only.)ashow
-642 90 gm
-0.11749 0. 32 0.01174 0.(Here is a sample dialog box, and it's entry in the .GDEmenus file:)awidthshow
-F T cp
-%%Page: ? 18
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(18)show
-454 408 241 216 th
-147 170 gm
-tu
-(nc 143 169 312 327 6 rc)kp
-ts
-{}mark T /Courier /|______Courier 0 rf
-8.33332 fz
-2 F /|______Courier fnt
-( )show
-165 170 gm
-(menu:Test function)show
-177 170 gm
-(item:All capitals)show
-182 170 gm
-(itemmethod:\(tr '[a-z]' '[A-Z]' < INPUT_FILE > )show
-188 170 gm
-(INPUT_FILE.tmp ; mv INPUT_FILE.tmp $SAVE_FILE_NAME ; gde )show
-194 170 gm
-($SAVE_FILE_NAME -Wx $SIZE ; rm INPUT_FILE\) &)show
-206 170 gm
-(arg:SAVE_FILE_NAME)show
-212 170 gm
-(argtype:text)show
-217 170 gm
-(arglabel:Save converted data as?)show
-223 170 gm
-(argtext:CAPS)show
-235 170 gm
-(arg:SIZE)show
-241 170 gm
-(arglabel:Text size?)show
-247 170 gm
-(argtype:chooser)show
-252 170 gm
-(argvalue:1)show
-258 170 gm
-(argchoice:Small:small)show
-264 170 gm
-(argchoice:Medium:medium)show
-270 170 gm
-(argchoice:Large:large)show
-276 170 gm
-(argchoice:Extra Large:extra_large)show
-288 170 gm
-(in:INPUT_FILE)show
-293 170 gm
-(informat:flat)show
-299 170 gm
-(insave:)show
-tu
-305 170 gm
-(nc 72 162 313 378 6 rc)kp
-64 gr
-73 166 142 355 1 rc
-0 gr
-73.5 166.5 141.5 354.5 0 rc
-64 gr
-79 174 89 193 12.5 12.5 1 rr
-0 gr
-79.5 174.5 88.5 192.5 12.5 12.5 0 rr
-64 gr
-77 172 137 352 1 rc
-0 gr
-T 180 31.07141 172 77 44 341 58 T 1 db
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000008000000000000004080000000000000000000000000000000000000000000000000000000000000
-0000F04204000007800000004040000000000000000000000000000000000000000000000000000000000000
-0001084404000008400000004040000000000000000000000000000000000000000000000000000000000000
-0002044802000010070B07384020000000000000000000000000000000000000000000000000000000000000
-0002045002000010088C88444020000000000000000000000000000000000000000000000000000000000000
-0002047002000010008890444020000000000000000000000000000000000000000000000000000000000000
-00020448020000100788907C4020000000000000000000000000000000000000000000000000000000000000
-0002044402000010088890404020000000000000000000000000000000000000000000000000000000000000
-0001084202000008488888444020000000000000000000000000000000000000000000000000000000000000
-0000F04202000007874887384020000000000000000000000000000000000000000000000000000000000000
-0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000
-0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000
-0000000008000000000000000080000000000000000000000000000000000000000000000000000000000000
-0100000010000800000000000100000000000000000000000000000000000000000000000000000000000000
-00C0000060000600000000000600000000000000000000000000000000000000000000000000000000000000
-003FFFFF800001FFFFFFFFFFF800000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000C00C0000000000000000000000000000000000000000000000000000000000
-03C00000000000000000008000C00C0040000000380000000000000000000000000000000000000000000000
-06600000000000000000018000C00C00C00000004C0000000000000000000000000000000000000000000000
-0603C663C03C786C663C6FE787C07C79F3C03C3E0C0000000000000000000000000000000000000000000000
-070666666066CC7666666D8CCCC0CCCCC6606660180000000000000000000000000000000000000000000000
-03C066666060CC666666718CCCC0CC0CC0600670300000000000000000000000000000000000000000000000
-00E3E347E060CC66347E618FCCC0CC7CC3E03E3C300000000000000000000000000000000000000000000000
-006663460060CC663460618C0CC0CCCCC660660E000000000000000000000000000000000000000000000000
-066661862062CC661862618C4DC0DCCCC6606606300000000000000000000000000000000000000000000000
-03C3B183C03C7866183C60E786C06C7673B03B7C300000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-01E0C1E1E0000000000000000000000000000000000000000000000000000000000000000000000000000000
-0210C11200000000000000000000000000000000000000000000000000000000000000000000000000000000
-0401211200000000000000000000000000000000000000000000000000000000000000000000000000000000
-0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000
-04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000
-0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000
-0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000
-T 180 30 172 108.05261 44 341 57 T 1 db
-0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000
-04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000
-0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000
-0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000
-0212110028000000000000000000000000000000000000000000000000000000000000000000000000000000
-01E21103C8000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000003E000000000000000000000000000000000000000000000000000000100000000000000000000000
-07FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF00000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000000000000000000000000000003FFFFFFFFFFFFFFFF000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000018000000000000000088030000000220000000000000000000800000000000000000001000000
-07F80002000180001C00003C0000088030082000220000000002000000000807C00800004000000001000000
-00C00006000000002600004000000880300C6000200000000002000000000804000800004000000001000000
-00C1E33F81F19F1E0600004059870880300C61C1E2222CC000020E2CF1C00804089EB38041C59E3801000000
-00C33336030183330C00006066488880300AA2222222332000021131122008040888C4404226224401000000
-00C331A6038186331800003844408880300AA222222222200002012112200807850880404024224401000000
-00C3F0C601E18E3F1800000C44478880300923E22222222000020F2113E00804020883C041E4227C01000000
-00C3016600718C30000000044448888030092202222222200002112132000804050884404224264001000000
-00C31336003198311800000444488880300822226226222000021120D22008040888844042241A4401000000
-00C1E33383E19F1E1800007844474880300821C1A21A22200003CEA011C00807C88683A079D4023801000000
-0000000000000000000000000000000030000000000000000000000010000800000000000000020001000000
-00000000000000000000000000000000300000000000000000000000E00008000000000000001C0001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-000000000000000000003FFFFFFFFFFFF00000000000000003FFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFF000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-64 gr
-77 172 137 352 1 rc
-0 gr
-T 180 31.07141 172 77 44 341 58 T 1 db
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000008000000000000004080000000000000000000000000000000000000000000000000000000000000
-0000F04204000007800000004040000000000000000000000000000000000000000000000000000000000000
-0001084404000008400000004040000000000000000000000000000000000000000000000000000000000000
-0002044802000010070B07384020000000000000000000000000000000000000000000000000000000000000
-0002045002000010088C88444020000000000000000000000000000000000000000000000000000000000000
-0002047002000010008890444020000000000000000000000000000000000000000000000000000000000000
-00020448020000100788907C4020000000000000000000000000000000000000000000000000000000000000
-0002044402000010088890404020000000000000000000000000000000000000000000000000000000000000
-0001084202000008488888444020000000000000000000000000000000000000000000000000000000000000
-0000F04202000007874887384020000000000000000000000000000000000000000000000000000000000000
-0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000
-0000000004000000000000000040000000000000000000000000000000000000000000000000000000000000
-0000000008000000000000000080000000000000000000000000000000000000000000000000000000000000
-0100000010000800000000000100000000000000000000000000000000000000000000000000000000000000
-00C0000060000600000000000600000000000000000000000000000000000000000000000000000000000000
-003FFFFF800001FFFFFFFFFFF800000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-00000000000000000000000000C00C0000000000000000000000000000000000000000000000000000000000
-03C00000000000000000008000C00C0040000000380000000000000000000000000000000000000000000000
-06600000000000000000018000C00C00C00000004C0000000000000000000000000000000000000000000000
-0603C663C03C786C663C6FE787C07C79F3C03C3E0C0000000000000000000000000000000000000000000000
-070666666066CC7666666D8CCCC0CCCCC6606660180000000000000000000000000000000000000000000000
-03C066666060CC666666718CCCC0CC0CC0600670300000000000000000000000000000000000000000000000
-00E3E347E060CC66347E618FCCC0CC7CC3E03E3C300000000000000000000000000000000000000000000000
-006663460060CC663460618C0CC0CCCCC660660E000000000000000000000000000000000000000000000000
-066661862062CC661862618C4DC0DCCCC6606606300000000000000000000000000000000000000000000000
-03C3B183C03C7866183C60E786C06C7673B03B7C300000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-01E0C1E1E0000000000000000000000000000000000000000000000000000000000000000000000000000000
-0210C11200000000000000000000000000000000000000000000000000000000000000000000000000000000
-0401211200000000000000000000000000000000000000000000000000000000000000000000000000000000
-0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000
-04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000
-0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000
-0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000
-T 180 30 172 108.05261 44 341 57 T 1 db
-0401211300000000000000000000000000000000000000000000000000000000000000000000000000000000
-04012111C0000000000000000000000000000000000000000000000000000000000000000000000000000000
-0403F1E060000000000000000000000000000000000000000000000000000000000000000000000000000000
-0402110020000000000000000000000000000000000000000000000000000000000000000000000000000000
-0212110028000000000000000000000000000000000000000000000000000000000000000000000000000000
-01E21103C8000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000001C000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000003E000000000000000000000000000000000000000000000000000000100000000000000000000000
-07FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF00000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-000000000000000000000000000000003FFFFFFFFFFFFFFFF000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000018000000000000000088030000000220000000000000000000800000000000000000001000000
-07F80002000180001C00003C0000088030082000220000000002000000000807C00800004000000001000000
-00C00006000000002600004000000880300C6000200000000002000000000804000800004000000001000000
-00C1E33F81F19F1E0600004059870880300C61C1E2222CC000020E2CF1C00804089EB38041C59E3801000000
-00C33336030183330C00006066488880300AA2222222332000021131122008040888C4404226224401000000
-00C331A6038186331800003844408880300AA222222222200002012112200807850880404024224401000000
-00C3F0C601E18E3F1800000C44478880300923E22222222000020F2113E00804020883C041E4227C01000000
-00C3016600718C30000000044448888030092202222222200002112132000804050884404224264001000000
-00C31336003198311800000444488880300822226226222000021120D22008040888844042241A4401000000
-00C1E33383E19F1E1800007844474880300821C1A21A22200003CEA011C00807C88683A079D4023801000000
-0000000000000000000000000000000030000000000000000000000010000800000000000000020001000000
-00000000000000000000000000000000300000000000000000000000E00008000000000000001C0001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-0000000000000000000000000000000030000000000000000000000000000800000000000000000001000000
-000000000000000000003FFFFFFFFFFFF00000000000000003FFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFF000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
-119 301 gm
-119 274 lin
-119 240 gm
-119 214 lin
-130 241 gm
-130 276 lin
-119 301 gm
-119 345 lin
-130 215 gm
-119 215 lin
-78.5 173.5 88.5 192.5 12.5 12.5 0 rr
-78.5 197.5 88.5 228.5 12.5 12.5 0 rr
-119 275 gm
-130 275 lin
-130 241 lin
-200.5 163.5 224.5 263.5 13.5 13.5 0 rr
-pr
-100 268 pl
-98 275 pl
-100 275 pl
-102 275 pl
-100 268 pl
-1 ep
-100 377 gm
-100 275 0 gr
-lin
-229.5 163.5 276.5 263.5 13.5 13.5 0 rr
-0 0 pen
-248 325 gm
-248 325 lin
-nc ct 39 0 put
-1 1 pen
-248 263 gm
-bp
-248 325 F qi
-248 325 qc
-248 363 qc
-248 363 qc
-124 363 qc
-124 363 F qq
-ef
-9 ec
-(nc 72 162 313 378 6 rc)kp
-248 363 gm
-pr
-124 349 pl
-122 356 pl
-124 356 pl
-126 356 pl
-124 349 pl
-1 ep
-124 363 gm
-124 356 0 gr
-lin
-100 377 gm
-215 377 lin
-215 263 gm
-215 377 lin
-322 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.02491 0.(Using the default parameters given in the dialog box, the executed Unix command line would be:)ashow
-341 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.20088 0.(\(tr '[a-z]' '[A-Z]' < .gde_001 >.gde_001.tmp ; mv .gde_001.tmp CAPS ; gde CAPS -Wx medium ; rm .gde_001 \) &)ashow
-363 90 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.06463 0.(where )ashow
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.06048 0.(.gde_001)ashow
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.05946 0.( is the name of the temporary file generated by the GDE which contains the selected sequences)ashow
-374 90 gm
-0.09124 0. 32 0.00912 0.(in flat file format. Since the GDE runs this command in the background \('&' at the end\) it is necessary to)awidthshow
-385 90 gm
-(specify the )show
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
-(insave: )show
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
--0.00428 0.(line, and to remove all temporary files manually. There is no output file specific because)ashow
-396 90 gm
--0.02909 0.(the data is not loaded back into the current GDE window, but rather a new GDE window is opened on the)ashow
-407 90 gm
--0.01303 0.(file. A simpler command that reloads the data after conversion might be:)ashow
-426 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.21559 0.(item:All caps)ashow
-434 90 gm
--0.20352 0.(itemmethod:tr '[a-z]' '[A-Z]' OUTPUT)ashow
-450 90 gm
--0.22743 0.(in:INPUT)ashow
-458 90 gm
--0.21559 0.(informat:flat)ashow
-474 90 gm
--0.22111 0.(out:OUTPUT)ashow
-482 90 gm
--0.21430 0.(outformat:flat)ashow
-501 90 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.06103 0. 32 0.00610 0.(In this example, no arguments are specified, and so no dialog box will appear. The command is not run in)awidthshow
-512 90 gm
--0.03242 0.(the background, so the GDE can clean up after itself automatically. The converted sequence is automatically)ashow
-523 90 gm
--0.07383 0.(loaded back into the current GDE window.)ashow
-545 90 gm
-0.02014 0. 32 0.00201 0.(In general, the easiest type of program to integrate into the GDE is a program completely driven from a)awidthshow
-556 90 gm
--0.00051 0.(Unix command line. Interactive programs can be tied in \(MFOLD for example\), however shell scripts must)ashow
-567 90 gm
--0.01737 0.(be used to drive the parameter entry for these programs. Programs of the form:)ashow
-586 90 gm
-{}mark T /Courier /|______Courier 0 rf
-7 fz
-2 F /|______Courier fnt
--0.20149 0.(program_name -a1 argument1 -a2 arguement2 -f inputfile -er errorfile > outputfile)ashow
-608 90 gm
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-10 fz
-2 F /|______Times-Roman fnt
-0.06240 0. 32 0.00624 0.(can be specified in the .GDEmenus file directly. As this is the general form of most one Unix commands,)awidthshow
-619 90 gm
-0.06774 0. 32 0.00677 0.(these tend to be simpler to implement under the GDE.)awidthshow
-641 90 gm
-0.07995 0. 32 0.00799 0.(As functions grow in complexity, they may begin to need a user interface of their own. In these cases, the)awidthshow
-652 90 gm
--0.01388 0.(command line calling arguments are still necessary in order to allow the GDE to hand them the appropriate)ashow
-663 90 gm
--0.02767 0.(data, and possible retrieve results after some external manipulation.)ashow
-F T cp
-%%Page: ? 19
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(19)show
-84 90 gm
-14 fz
-2 F /|______Times-Roman fnt
-0.49774 0. 32 0.04977 0.(Appendix C, External functions)awidthshow
-107 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.08163 0. 32 0.00816 0.(ClustalV - Cluster multiple sequence alignment)awidthshow
-129 90 gm
-0.30380 0. 32 0.03038 0.(Author: Des Higgins.)awidthshow
-151 90 gm
--0.25508 0.(Reference:)ashow
-151 162 gm
-0.14328 0. 32 0.01432 0.(Higgins,D.G. Bleasby,A.J. and Fuchs,R. \(1991\) CLUSTAL V: improved software)awidthshow
-162 162 gm
-0.13442 0. 32 0.01344 0.(for multiple sequence alignment. ms. submitted to CABIOS)awidthshow
-183 90 gm
--0.11924 0.(Parameters:)ashow
-194 162 gm
--0.07839 0.(k-tuple pairwise search)ashow
-194 270 gm
--0.07196 0.(Word size for pairwise comparisons)ashow
-205 162 gm
--0.14807 0.(Window size)ashow
-205 270 gm
-0.07278 0. 32 0.00727 0.(Smaller values give faster alignments,)awidthshow
-216 270 gm
--0.03422 0.(larger values are more sensitive.)ashow
-227 162 gm
--0.05999 0.(Transitions weighted)ashow
-227 270 gm
-0.19729 0. 32 0.01972 0.(Can weight transitions twice as high as)awidthshow
-238 270 gm
--0.01446 0.(transversions \(DNA only\).)ashow
-249 162 gm
--0.04051 0.(Fixed gap penalty)ashow
-249 270 gm
-0.06027 0. 32 0.00602 0.(Gap insertion penalty, lower value, more gaps)awidthshow
-260 162 gm
-0.20385 0. 32 0.02038 0.(Floating gap penalty)awidthshow
-260 270 gm
-0.02777 0. 32 0.00277 0.(Gap extension penalty, lower value, longer gaps)awidthshow
-304 90 gm
-0.11117 0.(Comments:)ashow
-315 162 gm
--0.01083 0.(ClustalV is a directed multiple sequence alignment algorithm that)ashow
-326 162 gm
-0.06652 0. 32 0.00665 0.(aligns a set of sequences based on their level of similarity. It first)awidthshow
-337 162 gm
-0.05584 0. 32 0.00558 0.(uses a Lipman Peasron pairwise similarity scoring to find "clusters")awidthshow
-348 162 gm
--0.06562 0.(of similar sequences, and pre-aligns those sequences. It then adds)ashow
-359 162 gm
-0.03463 0. 32 0.00346 0.(other sequences to the alignment in the order of their similarity so as)awidthshow
-370 162 gm
--0.02696 0.(to produce the cleanest alignment.)ashow
-392 162 gm
-0.09170 0. 32 0.00917 0.(Warning: ClustalV only uses unambiguous character codes. It will also)awidthshow
-403 162 gm
-0.04348 0. 32 0.00434 0.(convert all sequences to upper case in the process of aligning. Clustal)awidthshow
-414 162 gm
-0.04180 0. 32 0.00418 0.(does not pass back comments, author etc. Be sure to keep copies of your)awidthshow
-425 162 gm
-0.15106 0. 32 0.01510 0.(sequences if you do not wish to lose this information.)awidthshow
-F T cp
-%%Page: ? 20
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(20)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.08074 0.(MFOLD - RNA secondary prediction)ashow
-103 90 gm
--0.03694 0.(Author: Michael Zuker)ashow
-125 90 gm
--0.17959 0.(Reference: )ashow
-125 162 gm
-0.13900 0. 32 0.01390 0.(M. Zuker)awidthshow
-136 162 gm
-0.27359 0. 32 0.02735 0.(On Finding All Suboptimal Foldings of an RNA Molecule.)awidthshow
-147 162 gm
-0.16525 0. 32 0.01652 0.(Science, 244, 48-52, \(1989\))awidthshow
-169 162 gm
-0.12847 0. 32 0.01284 0.(J. A. Jaeger, D. H. Turner and M. Zuker)awidthshow
-180 162 gm
--0.06132 0.(Improved Predictions of Secondary Structures for RNA.)ashow
-191 162 gm
-0.25482 0. 32 0.02548 0.(Proc. Natl. Acad. Sci. USA, BIOCHEMISTRY, 86, 7706-7710, \(1989\))awidthshow
-213 162 gm
-0.12847 0. 32 0.01284 0.(J. A. Jaeger, D. H. Turner and M. Zuker)awidthshow
-224 162 gm
--0.01690 0.(Predicting Optimal and Suboptimal Secondary Structure for RNA.)ashow
-235 162 gm
-0.13473 0. 32 0.01347 0.(in "Molecular Evolution: Computer Analysis of Protein and)awidthshow
-246 162 gm
-(Nucleic Acid Sequences", R. F. Doolittle ed.)show
-257 162 gm
-0.18035 0. 32 0.01803 0.(Methods in Enzymology, 183, 281-306 \(1989\))awidthshow
-279 90 gm
--0.11924 0.(Parameters:)ashow
-290 162 gm
--0.11352 0.(Linear/circular RNA fold)ashow
-301 162 gm
-0.25527 0. 32 0.02552 0.(ct File to save results)awidthshow
-323 90 gm
-0.11117 0.(Comments:)ashow
-334 162 gm
-0.06652 0. 32 0.00665 0.(MFOLD passes it's output to a program Zuk_to_gen that translates the secondary)awidthshow
-345 162 gm
--0.01971 0.(structure prediction to a nested bracket \([]\) notation. This notation can then be used)ashow
-356 162 gm
--0.00996 0.(in the Highlight Helix, and Draw Secondary structure \(LoopTool\) functions.)ashow
-378 162 gm
--0.01683 0.(MFOLD currently does not support much in the way of additional parameters.)ashow
-389 162 gm
--0.04089 0.(We hope to have all additional parameters available soon.)ashow
-F T cp
-%%Page: ? 21
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(21)show
-92 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01799 0.(Blast - Basic Local Alignment Search Tool)ashow
-114 90 gm
--0.25508 0.(Reference:)ashow
-125 162 gm
-0.16143 0. 32 0.01614 0.(Karlin, Samuel and Stephen F. Altschul \(1990\). Methods for)awidthshow
-136 162 gm
--0.04147 0.(assessing the statistical significance of molecular sequence)ashow
-147 162 gm
--0.01135 0.(features by using general scoring schemes, Proc. Natl. Acad.)ashow
-158 162 gm
-0.51742 0. 32 0.05174 0.(Sci. USA 87:2264-2268.)awidthshow
-180 90 gm
-0.46295 0. 32 0.04629 0.( )awidthshow
-180 162 gm
-0.27801 0. 32 0.02780 0.(Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W.)awidthshow
-191 90 gm
-0.46295 0. 32 0.04629 0.( )awidthshow
-191 162 gm
-0.10040 0. 32 0.01004 0.(Myers, and David J. Lipman \(1990\). Basic local alignment)awidthshow
-202 90 gm
-0.46295 0. 32 0.04629 0.( )awidthshow
-202 162 gm
-0.45684 0. 32 0.04568 0.(search tool, J. Mol. Biol. 215:403-410.)awidthshow
-224 90 gm
-0.46875 0. 32 0.04687 0.( )awidthshow
-224 162 gm
-0.40649 0. 32 0.04064 0.(Altschul, Stephen F. \(1991\). Amino acid substitution)awidthshow
-235 90 gm
-0.46875 0. 32 0.04687 0.( )awidthshow
-235 162 gm
-0.10742 0. 32 0.01074 0.(matrices from an information theoretic perspective. J. Mol.)awidthshow
-246 90 gm
-0.46295 0. 32 0.04629 0.( )awidthshow
-246 162 gm
-0.43884 0. 32 0.04388 0.(Biol. 219:555-565.)awidthshow
-290 90 gm
--0.11924 0.(Parameters:)ashow
-301 162 gm
--0.13816 0.(Which Database)ashow
-301 270 gm
--0.09788 0.(Which nucleic or amino acid database)ashow
-312 270 gm
--0.03448 0.(to search.)ashow
-334 162 gm
--0.18505 0.(Word Size)ashow
-334 270 gm
-0.17608 0. 32 0.01760 0.(Length of initial hit. after locating a match of)awidthshow
-345 270 gm
-0.27908 0. 32 0.02790 0.(this length, alignment extension is attempted.)awidthshow
-356 126 gm
--0.11082 0.(Blastn)ashow
-367 162 gm
--0.11381 0.(Match score)ashow
-367 270 gm
--0.03680 0.(Score for matches in secondary alignment extension)ashow
-378 162 gm
--0.04492 0.(Mismatch score)ashow
-378 270 gm
--0.02404 0.(Score for mismatches in secondary alignment extension)ashow
-400 126 gm
-0.49514 0. 32 0.04951 0.(Blastx, tblastn, blastp, blast3)awidthshow
-411 162 gm
-0.69580 0. 32 0.06958 0.(Substitution Matrix)awidthshow
-411 270 gm
-0.38192 0. 32 0.03819 0.(PAM120 or PAM250)awidthshow
-444 126 gm
-0.11117 0.(Comments:)ashow
-444 198 gm
--0.01263 0.(The report is loaded into a text editor. This should be saved as a new file)ashow
-455 198 gm
--0.01432 0.(as the default file is removed after execution. The latest version of blast can)ashow
-466 198 gm
-0.30914 0. 32 0.03091 0.(be obtained via anonymous ftp to ncbi.nlm.nih.gov.)awidthshow
-F T cp
-%%Page: ? 22
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(22)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.14083 0. 32 0.01408 0.(FastA - Similarity search)awidthshow
-103 126 gm
--0.25508 0.(Reference:)ashow
-114 162 gm
-0.31677 0. 32 0.03167 0.(W. R. Pearson and D. J. Lipman \(1988\),)awidthshow
-125 162 gm
--0.00869 0.("Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448)ashow
-147 162 gm
-0.01358 0. 32 0.00135 0.(W. R. Pearson \(1990\) "Rapid and Sensitive Sequence)awidthshow
-158 162 gm
-0.26550 0. 32 0.02655 0.(Comparison with FASTP and FASTA" Methods in Enzymology 183:63-98)awidthshow
-180 126 gm
--0.11924 0.(Parameters:)ashow
-191 162 gm
--0.23434 0.(Database)ashow
-191 306 gm
--0.12551 0.(Which database to search)ashow
-202 162 gm
-0.05493 0. 32 0.00549 0.(Number of alignments to report)awidthshow
-213 162 gm
-(SMATRIX)show
-213 306 gm
-0.26260 0. 32 0.02626 0.(Which similarity matrix to use)awidthshow
-246 126 gm
-0.11117 0.(Comments:)ashow
-257 90 gm
-0.47622 0. 32 0.04762 0.( )awidthshow
-257 162 gm
--0.05303 0.(The FastA package includes several additional programs for pairwise alignment.)ashow
-268 162 gm
--0.00224 0.(We have only included a bare bones link to FastA. We hope to include a more)ashow
-279 162 gm
--0.00607 0.(complete setup for the actual 2.0 release.)ashow
-F T cp
-%%Page: ? 23
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(23)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.38360 0. 32 0.03836 0.(Assemble Contigs - CAP Contig Assembly Program)awidthshow
-103 126 gm
--0.04878 0.(Author - Xiaoqiu Huang)ashow
-114 162 gm
--0.03823 0.(Department of Computer Science)ashow
-125 162 gm
--0.02279 0.(Michigan Technological University)ashow
-136 162 gm
-0.34759 0. 32 0.03475 0.(Houghton, MI 49931)awidthshow
-147 162 gm
--0.01989 0.(E-mail: huang@cs.mtu.edu)ashow
-169 162 gm
-0.31494 0. 32 0.03149 0.(Minor modifications for I/O by S. Smith)awidthshow
-191 126 gm
--0.23449 0.(Reference -)ashow
-202 162 gm
-0.05538 0. 32 0.00553 0.("A Contig Assembly Program Based on Sensitive Detection of)awidthshow
-213 90 gm
-( )show
-213 162 gm
-0.00946 0. 32 0.00094 0.(Fragment Overlaps" \(submitted to Genomics, 1991\))awidthshow
-235 126 gm
--0.11924 0.(Parameters:)ashow
-246 162 gm
-0.21423 0. 32 0.02142 0.(Minimum overlap)awidthshow
-246 306 gm
--0.11988 0.(Number of bases required for overlap)ashow
-257 162 gm
--0.01672 0.(Percent match within overlap)ashow
-257 306 gm
--0.10456 0.(Percentage match required in the overlap)ashow
-268 306 gm
--0.07734 0.(region before merge is alowwed.)ashow
-290 126 gm
-0.11117 0.(Comments:)ashow
-312 162 gm
--0.06814 0.(CAP returns the aligned sequences to the current editor window. The sequences are)ashow
-323 162 gm
-0.00427 0. 32 0.00042 0.(placed into contigs by setting the groupid. Cap does not change the order of the)awidthshow
-334 162 gm
--0.05079 0.(sequences, and so the results should be sorted by group and offset \(see sort under the)ashow
-345 162 gm
--0.02096 0.(Edit menu\).)ashow
-F T cp
-%%Page: ? 24
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(24)show
-92 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.10661 0.(Lsadt - Least squares additive tree analysis)ashow
-114 90 gm
-0.18157 0. 32 0.01815 0.(Author: Geert De Soete, 'C' implementation by Mike Maciukenas University of Illinois)awidthshow
-136 90 gm
--0.00590 0.(Reference:LSADT, 1983 Psychometrika, 1984 Quality and Quantity)ashow
-158 90 gm
--0.11924 0.(Parameters:)ashow
-169 162 gm
--0.02085 0.(Distance correction to use in distance matrix calculations \(see count below\).)ashow
-180 162 gm
--0.03211 0.(What should be used for initial parameters estimates)ashow
-191 162 gm
--0.12921 0.(Random number seed)ashow
-202 162 gm
--0.05371 0.(Display method \(See TreeTool below\))ashow
-224 90 gm
-0.11117 0.(Comments:)ashow
-235 162 gm
--0.02113 0.(The program has been rewritten in 'C' and will be included with the rRNA Database)ashow
-246 162 gm
-0.03906 0. 32 0.00390 0.(phylogenetic package being written at the University of Illinois Department of)awidthshow
-257 162 gm
-0.04248 0.(Microbiology.)ashow
-279 162 gm
--0.01466 0.(Count is a short program to calculate a distance matrix from a sequence)ashow
-290 162 gm
--0.01652 0.(alignment \(see below\).)ashow
-334 90 gm
--0.00831 0.(Count - Distance matrix calculator)ashow
-356 90 gm
-0.45852 0. 32 0.04585 0.(Author: Steven Smith)awidthshow
-378 90 gm
--0.11924 0.(Parameters:)ashow
-389 162 gm
--0.07836 0.(Correction method)ashow
-389 306 gm
--0.01190 0.(Currently Jukes-Cantor or none)ashow
-400 162 gm
--0.17300 0.(Include dashed columns)ashow
-411 162 gm
--0.04403 0.(Match upper case to lower)ashow
-444 90 gm
-0.11117 0.(Comments:)ashow
-455 162 gm
--0.02917 0.(Passes back a distance matrix in a format readable by LSADT.)ashow
-510 90 gm
--0.06629 0.(Treetool - Tree drawing/manipulation)ashow
-532 90 gm
--0.01724 0.(Author:)ashow
-532 126 gm
-0.06912 0. 32 0.00691 0.(Michael Maciukenas, University of Illinois)awidthshow
-554 90 gm
-0.11117 0.(Comments:)ashow
-565 162 gm
--0.08711 0.(See included documentation for TreeTool usage.)ashow
-F T cp
-%%Page: ? 25
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(25)show
-81 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-0.08056 0. 32 0.00805 0.(Phylip - Complete phylogenetic analysis package \(3.4\))awidthshow
-103 90 gm
-0.13824 0. 32 0.01382 0.(Author: Joe Felsenstein)awidthshow
-125 90 gm
--0.25508 0.(Reference:)ashow
-125 162 gm
-0.12664 0. 32 0.01266 0.(Felsenstein, J. 1989. PHYLIP -- Phylogeny Inference Package \(Version 3.2\).)awidthshow
-136 162 gm
-0.18722 0. 32 0.01872 0.(Cladistics 5: 164-166)awidthshow
-169 90 gm
-0.11117 0.(Comments:)ashow
-180 162 gm
-0.13565 0. 32 0.01356 0.(Phylip is a very complete set of programs for phylogenetic analysis. GDE)awidthshow
-191 162 gm
--0.00163 0.(simply formats selected data \(obeying any selection mask\) to Phylip, and runs)ashow
-202 162 gm
-0.06301 0. 32 0.00630 0.(the chosen program. Although all programs from Phylip are included, only)awidthshow
-213 162 gm
-0.11154 0. 32 0.01115 0.(the programs pertaining to DNA/AA analysis are tied in to the menu system.)awidthshow
-224 162 gm
--0.06831 0.(The complete set of documentation is included, and can be viewed directly from)ashow
-235 162 gm
--0.00129 0.(GDE. It is strongly suggested that user read the documentation before attempting to)ashow
-246 162 gm
-(interpret results.)show
-268 162 gm
--0.02252 0.(The full source code for Phylip can be obtained from genetics.washington.edu using)ashow
-279 162 gm
-0.34255 0. 32 0.03425 0.(anonymous ftp.)awidthshow
-F T cp
-%%Page: ? 26
-op
-31 30 xl
-1 1 pen
-753 90 gm
-(nc 31 30 761 582 6 rc)kp
-0 gr
-T 1 setTxMode
-0 fs
-{}mark T /Times-Roman /|______Times-Roman 0 rf
-7 fz
-2 F /|______Times-Roman fnt
-0.34057 0. 32 0.03405 0.(GDE2.0 rev1)awidthshow
-753 300 gm
-12 fz
-2 F /|______Times-Roman fnt
-(26)show
-92 90 gm
--0.10993 0.(Copyright Notice)ashow
-115 90 gm
-10 fz
-2 F /|______Times-Roman fnt
--0.01510 0.(The Genetic Data Environment \(GDE\) software and documentation are not in the public domain. Portions)ashow
-126 90 gm
--0.04327 0.(of this code are owned and copyrighted by the The Board of Trustees of the University of Illinois and by)ashow
-137 90 gm
--0.03067 0.(Steven Smith at the Harvard Genome Laboratory. This release of the GDE program and documentation)ashow
-148 90 gm
--0.00248 0.(may not be sold, or incorporated into a commercial product, in whole or in part without the expressed)ashow
-159 90 gm
-0.24673 0. 32 0.02467 0.(written consent of the University of Illinois and of its author, Steven Smith.)awidthshow
-181 90 gm
--0.01826 0.(All interested parties may redistribute the GDE as long as all copies are accompanied by this)ashow
-192 90 gm
-0.05432 0. 32 0.00543 0.(documentation, and all copyright notices remain intact. Parties interested in redistribution must do so on a)awidthshow
-203 90 gm
--0.03430 0.(non-profit basis, charging only for cost of media. Modifications to the GDE core editor should be forwarded)ashow
-214 90 gm
-0.04577 0. 32 0.00457 0.(to the author Steven Smith at the address given below for inclusion into future releases. External programs)awidthshow
-225 90 gm
--0.02499 0.(used by the GDE are copyright by, and are the property of their respective authors unless otherwise stated.)ashow
-258 90 gm
-0.02899 0. 32 0.00289 0.(While all attempts have been made to insure the integrity of these programs:)awidthshow
-280 90 gm
-12 fz
-2 F /|______Times-Roman fnt
--0.29307 0.(Disclaimer)ashow
-303 90 gm
-10 fz
-2 F /|______Times-Roman fnt
-(THE UNIVERSITY OF ILLINOIS, HARVARD UNIVERSITY AND THE AUTHOR, STEVEN SMITH)show
-314 90 gm
-0.21240 0. 32 0.02124 0.(GIVE NO WARRANTIES, EXPRESSED OR IMPLIED FOR THE SOFTWARE AND)awidthshow
-325 90 gm
--0.03628 0.(DOCUMENTATION PROVIDED, INCLUDING, BUT NOT LIMITED TO WARRANTY OF)ashow
-336 90 gm
-0.20996 0. 32 0.02099 0.(MERCHANTABILITY AND WARRANTY OF FITNESS FOR A PARTICULAR PURPOSE. User)awidthshow
-347 90 gm
--0.06015 0.(understands the software is a research tool for which no warranties as to capabilities or accuracy are made,)ashow
-358 90 gm
--0.01759 0.(and user accepts the software "as is." User assumes the entire risk as to the results and performance of the)ashow
-369 90 gm
--0.05845 0.(software and documentation. The above parties cannot be held liable for any direct, indirect, consequential)ashow
-380 90 gm
--0.00201 0.(or incidental damages with respect to any claim by user or any third party on account of, or arising from the)ashow
-391 90 gm
--0.05157 0.(use of software and associated materials. This disclaimer covers both the GDE core editor and all external)ashow
-402 90 gm
--0.01464 0.(programs used by the GDE.)ashow
-F T cp
-%%Trailer
-cd
-end
-%%Pages: 26 0
-%%EOF
diff --git a/README.md b/README.md
new file mode 100644
index 0000000..644daa6
--- /dev/null
+++ b/README.md
@@ -0,0 +1,11 @@
+# Genetic Data Environment
+
+GDE is originally distributed under SunOS in the 1990s by [Eisen](https://doi.org/10.1385/0-89603-358-9:13).
+
+This software is fixed from [Oliveira et al. (2003)](http://dx.doi.org/10.1093/bioinformatics/19.1.153) and re-distributed here.
+
+# Usage
+
+Though the dependency of GDE, xview, is orphaned by quite a lot of distributions, I still fix the software to give an outlook of how biologists worked during the last centenary.
+
+To use it, you must install xview lib and include. xview hardly work well on x86_64 architecture.
diff --git a/bin/CAP2 b/bin/CAP2
deleted file mode 100755
index e239ab7..0000000
Binary files a/bin/CAP2 and /dev/null differ
diff --git a/bin/Install.csh b/bin/Install.csh
deleted file mode 100755
index 9845227..0000000
--- a/bin/Install.csh
+++ /dev/null
@@ -1,53 +0,0 @@
-#/bin/csh
-
-mkdir bin
-
-#echo "Making blast..."
-#cd BLAST
-#Install.sh
-#cd ..
-
-echo "Making clustal..."
-cd CLUSTAL
-make
-cd ..
-
-echo "Making core GDE editor"
-cd CORE
-install.csh
-cd ..
-
-echo "Making FASTA"
-cd FASTA
-install.csh
-cd ..
-
-echo "Making Harvard Genome Lab functions"
-cd HGL_SRC
-install.csh
-cd ..
-
-echo "Making looptool"
-cd LOOPTOOL
-make
-cd ..
-
-echo "Making PHYLIP"
-cd PHYLIP
-install.csh
-cd ..
-
-echo "Making ReadSeq"
-cd READSEQ
-install.csh
-cd ..
-
-echo "Making other support programs"
-cd SUPPORT
-make
-cd ..
-
-echo "Making Zuker MFOLD"
-cd ZUKER
-install.csh
-cd ..
diff --git a/bin/LoopTool b/bin/LoopTool
deleted file mode 100755
index 3b32028..0000000
Binary files a/bin/LoopTool and /dev/null differ
diff --git a/bin/Restriction b/bin/Restriction
deleted file mode 100755
index adcceec..0000000
Binary files a/bin/Restriction and /dev/null differ
diff --git a/bin/Zuk_to_gen b/bin/Zuk_to_gen
deleted file mode 100755
index 4916b60..0000000
Binary files a/bin/Zuk_to_gen and /dev/null differ
diff --git a/bin/count b/bin/count
deleted file mode 100755
index a9eeec2..0000000
Binary files a/bin/count and /dev/null differ
diff --git a/bin/fasta2VESPA.pl b/bin/fasta2VESPA.pl
deleted file mode 100755
index 38c836e..0000000
--- a/bin/fasta2VESPA.pl
+++ /dev/null
@@ -1,47 +0,0 @@
-#!/usr/bin/perl
-
-
-##############################################################
-# @author : Wagied Davids
-# @progname : fasta2snap.pl
-# @proglang : Perl script
-# @purpose : Fasta to SNAP format converter
-# @input : Fasta format files
-# @output : SNAP format files
-# @date : 05.08.2001
-# @version : 0.001
-##############################################################
-
-
-
-use strict;
-
-my ($fileIN,$fileOUT);
-my ($de,@seq);
-my $seq;
-
-$fileIN= "infile";
-#$fileOUT=" ";
-
-open( FHIN, "$fileIN") || die "Error:$!";
-#open( FHOUT, ">$fileOUT" ) || die "Error:$!";
-
-$/="%"; #input record seperator
-
-while(){
-
- ($de,@seq)=split;
- $seq=join("",@seq);
- $seq= uc($seq);
-
-
- $seq= substr($seq,0,-1); #> remaining at the end
- print "$de\t\t$seq\n";
- #print FHOUT "$counter$de$seq\n";
- #print FHOUT "$de$seq\n";
-
-
-}
-close(FHIN);
-#close(FHOUT);
-
diff --git a/bin/fasta2VESPA.pl~ b/bin/fasta2VESPA.pl~
deleted file mode 100755
index f384694..0000000
--- a/bin/fasta2VESPA.pl~
+++ /dev/null
@@ -1,47 +0,0 @@
-#!/usr/bin/perl
-
-
-##############################################################
-# @author : Wagied Davids
-# @progname : fasta2snap.pl
-# @proglang : Perl script
-# @purpose : Fasta to SNAP format converter
-# @input : Fasta format files
-# @output : SNAP format files
-# @date : 05.08.2001
-# @version : 0.001
-##############################################################
-
-
-
-use strict;
-
-my ($fileIN,$fileOUT);
-my ($de,@seq);
-my $seq;
-
-$fileIN= "infile";
-#$fileOUT=" ";
-
-open( FHIN, "$fileIN") || die "Error:$!";
-#open( FHOUT, ">$fileOUT" ) || die "Error:$!";
-
-$/="%"; #input record seperator
-
-while(){
-
- ($de,@seq)=split;
- $seq=join("",@seq);
- $seq= uc($seq);
-
-
- $seq= substr($seq,0,-1); #> remaining at the end
- print "$de\t$seq\n";
- #print FHOUT "$counter$de$seq\n";
- #print FHOUT "$de$seq\n";
-
-
-}
-close(FHIN);
-#close(FHOUT);
-
diff --git a/bin/fasta2snap.pl b/bin/fasta2snap.pl
deleted file mode 100755
index 76b358d..0000000
--- a/bin/fasta2snap.pl
+++ /dev/null
@@ -1,47 +0,0 @@
-#!/usr/bin/perl
-
-
-##############################################################
-# @author : Wagied Davids
-# @progname : fasta2snap.pl
-# @proglang : Perl script
-# @purpose : Fasta to SNAP format converter
-# @input : Fasta format files
-# @output : SNAP format files
-# @date : 05.08.2001
-# @version : 0.001
-##############################################################
-
-
-
-use strict;
-
-my ($fileIN,$fileOUT);
-my ($de,@seq);
-my $seq;
-
-$fileIN= "infile";
-#$fileOUT=" ";
-
-open( FHIN, "$fileIN") || die "Error:$!";
-#open( FHOUT, ">$fileOUT" ) || die "Error:$!";
-
-$/="#"; #input record seperator
-
-while(){
-
- ($de,@seq)=split;
- $seq=join("",@seq);
- $seq= uc($seq);
-
-
- $seq= substr($seq,0,-1); #> remaining at the end
- print "$de\t$seq\n";
- #print FHOUT "$counter$de$seq\n";
- #print FHOUT "$de$seq\n";
-
-
-}
-close(FHIN);
-#close(FHOUT);
-
diff --git a/bin/fasta2snap.pl~ b/bin/fasta2snap.pl~
deleted file mode 100755
index 38f5ca0..0000000
--- a/bin/fasta2snap.pl~
+++ /dev/null
@@ -1,47 +0,0 @@
-#!/usr/bin/perl
-
-
-##############################################################
-# @author : Wagied Davids
-# @progname : fasta2snap.pl
-# @proglang : Perl script
-# @purpose : Fasta to SNAP format converter
-# @input : Fasta format files
-# @output : SNAP format files
-# @date : 05.08.2001
-# @version : 0.001
-##############################################################
-
-
-
-use strict;
-
-my ($fileIN,$fileOUT);
-my ($de,@seq);
-my $seq;
-
-$fileIN= "infile";
-#$fileOUT=" ";
-
-open( FHIN, "$fileIN") || die "Error:$!";
-#open( FHOUT, ">$fileOUT" ) || die "Error:$!";
-
-$/=">"; #input record seperator
-
-while(){
-
- ($de,@seq)=split;
- $seq=join("",@seq);
- $seq= uc($seq);
-
-
- $seq= substr($seq,0,-1); #> remaining at the end
- print "$de\t$seq\n";
- #print FHOUT "$counter$de$seq\n";
- #print FHOUT "$de$seq\n";
-
-
-}
-close(FHIN);
-#close(FHOUT);
-
diff --git a/bin/findall b/bin/findall
deleted file mode 100755
index 7f200bc..0000000
Binary files a/bin/findall and /dev/null differ
diff --git a/bin/gde b/bin/gde
deleted file mode 100755
index 3d64405..0000000
Binary files a/bin/gde and /dev/null differ
diff --git a/bin/installBLASTDB.pl b/bin/installBLASTDB.pl
deleted file mode 100755
index 7deadc0..0000000
--- a/bin/installBLASTDB.pl
+++ /dev/null
@@ -1,52 +0,0 @@
-#!/usr/bin/perl -w
-use strict;
-
-my $newFileName;
-my $line;
-
-my $sourceFile = shift;
-my $menuName = shift;
-
-print("mv -f ./$sourceFile.* /usr/local/bio/db/\n");
-print("cp -f ./$sourceFile /usr/local/bio/db/\n");
-
-
-
-print system("mv -f ./$sourceFile.* /usr/local/bio/db/");
-# or die ("cannot copy files\n");
-print system("cp -f ./$sourceFile /usr/local/bio/db/") ;
-#or die ("cannot copy file\n");
-
-
-open(MENUFILE, "/usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/bio/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^arg:BLASTDBDNA/){
- print "FOUND\n";
- while (){
- print NEWFILE;
- if (/^argchoice:/){
- print NEWFILE "argchoice:$menuName:/usr/local/bio/db/$sourceFile\n";
- last READLOOP;
- }
- }
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-print "new file: $newFileName\n";
-system("cp $newFileName /usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/installBLASTDB.pl~ b/bin/installBLASTDB.pl~
deleted file mode 100755
index 977e53b..0000000
--- a/bin/installBLASTDB.pl~
+++ /dev/null
@@ -1,52 +0,0 @@
-#!/usr/bin/perl -w
-use strict;
-
-my $newFileName;
-my $line;
-
-my $sourceFile = shift;
-my $menuName = shift;
-
-print("mv -f ./$sourceFile.* /usr/local/biotools/db/\n");
-print("cp -f ./$sourceFile /usr/local/biotools/db/\n");
-
-
-
-print system("mv -f ./$sourceFile.* /usr/local/biotools/db/");
-# or die ("cannot copy files\n");
-print system("cp -f ./$sourceFile /usr/local/biotools/db/") ;
-#or die ("cannot copy file\n");
-
-
-open(MENUFILE, "/usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/biotools/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^arg:BLASTDBDNA/){
- print "FOUND\n";
- while (){
- print NEWFILE;
- if (/^argchoice:/){
- print NEWFILE "argchoice:$menuName:/usr/local/biotools/db/$sourceFile\n";
- last READLOOP;
- }
- }
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-print "new file: $newFileName\n";
-system("cp $newFileName /usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/installBLASTDBPROT.pl b/bin/installBLASTDBPROT.pl
deleted file mode 100755
index f1cd486..0000000
--- a/bin/installBLASTDBPROT.pl
+++ /dev/null
@@ -1,52 +0,0 @@
-#!/usr/bin/perl -w
-use strict;
-
-my $newFileName;
-my $line;
-
-my $sourceFile = shift;
-my $menuName = shift;
-
-print("mv -f ./$sourceFile.* /usr/local/bio/db/\n");
-print("cp -f ./$sourceFile /usr/local/bio/db/\n");
-
-
-
-print system("mv -f ./$sourceFile.* /usr/local/bio/db/");
-# or die ("cannot copy files\n");
-print system("cp -f ./$sourceFile /usr/local/bio/db/") ;
-#or die ("cannot copy file\n");
-
-
-open(MENUFILE, "/usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/bio/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^arg:BLASTDBPROT/){
- print "FOUND\n";
- while (){
- print NEWFILE;
- if (/^argchoice:/){
- print NEWFILE "argchoice:$menuName:/usr/local/bio/db/$sourceFile\n";
- last READLOOP;
- }
- }
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-print "new file: $newFileName\n";
-system("cp $newFileName /usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/installBLASTDBPROT.pl~ b/bin/installBLASTDBPROT.pl~
deleted file mode 100755
index fcb8c41..0000000
--- a/bin/installBLASTDBPROT.pl~
+++ /dev/null
@@ -1,52 +0,0 @@
-#!/usr/bin/perl -w
-use strict;
-
-my $newFileName;
-my $line;
-
-my $sourceFile = shift;
-my $menuName = shift;
-
-print("mv -f ./$sourceFile.* /usr/local/biotools/db/\n");
-print("cp -f ./$sourceFile /usr/local/biotools/db/\n");
-
-
-
-print system("mv -f ./$sourceFile.* /usr/local/biotools/db/");
-# or die ("cannot copy files\n");
-print system("cp -f ./$sourceFile /usr/local/biotools/db/") ;
-#or die ("cannot copy file\n");
-
-
-open(MENUFILE, "/usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/biotools/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^arg:BLASTDBPROT/){
- print "FOUND\n";
- while (){
- print NEWFILE;
- if (/^argchoice:/){
- print NEWFILE "argchoice:$menuName:/usr/local/biotools/db/$sourceFile\n";
- last READLOOP;
- }
- }
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-print "new file: $newFileName\n";
-system("cp $newFileName /usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/lsadt b/bin/lsadt
deleted file mode 100755
index 1b4d297..0000000
Binary files a/bin/lsadt and /dev/null differ
diff --git a/bin/newDATASET.pl b/bin/newDATASET.pl
deleted file mode 100755
index d936ace..0000000
--- a/bin/newDATASET.pl
+++ /dev/null
@@ -1,37 +0,0 @@
-#!/usr/bin/perl
-
-
-my $name = shift;
-my $file = shift;
-
-open(MENUFILE, "/usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/bio/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^menu:seq. datasets/){
- print "FOUND\n";
- print NEWFILE "item:$name\n";
- print NEWFILE "itemmethod:readseq /usr/local/bio/GDE/db/$file -a -f2 > OUTPUTFILE;/bin/rm -f OUTFILE.tmp\n";
- print NEWFILE "out:OUTPUTFILE\n";
- print NEWFILE "outformat:genbank\n\n";\
- last READLOOP;
-
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-
-system("cp $newFileName /usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/newDATASET.pl~ b/bin/newDATASET.pl~
deleted file mode 100755
index e014012..0000000
--- a/bin/newDATASET.pl~
+++ /dev/null
@@ -1,37 +0,0 @@
-#!/usr/bin/perl
-
-
-my $name = shift;
-my $file = shift;
-
-open(MENUFILE, "/usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/biotools/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^menu:seq. datasets/){
- print "FOUND\n";
- print NEWFILE "item:$name\n";
- print NEWFILE "itemmethod:readseq /usr/local/biotools/GDE/db/$file -a -f2 > OUTPUTFILE;/bin/rm -f OUTFILE.tmp\n";
- print NEWFILE "out:OUTPUTFILE\n";
- print NEWFILE "outformat:genbank\n\n";\
- last READLOOP;
-
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-
-system("cp $newFileName /usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/newURL.pl b/bin/newURL.pl
deleted file mode 100755
index 468f112..0000000
--- a/bin/newURL.pl
+++ /dev/null
@@ -1,35 +0,0 @@
-#!/usr/bin/perl
-
-
-my $urlname = shift;
-my $url = shift;
-
-open(MENUFILE, "/usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/bio/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^menu:On-Line/){
- print "FOUND\n";
- print NEWFILE "item:$urlname\n";
- print NEWFILE "itemmethod:netscape $url &\n";
- last READLOOP;
-
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-
-system("cp $newFileName /usr/local/bio/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/newURL.pl~ b/bin/newURL.pl~
deleted file mode 100755
index ccfb52b..0000000
--- a/bin/newURL.pl~
+++ /dev/null
@@ -1,35 +0,0 @@
-#!/usr/bin/perl
-
-
-my $urlname = shift;
-my $url = shift;
-
-open(MENUFILE, "/usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot open menu file, sorry\n";
-$newFileName = "/usr/local/biotools/GDE/CORE/.GDEmenusNew";
-open(NEWFILE, ">$newFileName");
- READLOOP:
- while (){
- print NEWFILE;
- if (/^menu:On-Line/){
- print "FOUND\n";
- print NEWFILE "item:$urlname\n";
- print NEWFILE "itemmethod:netscape $url &\n";
- last READLOOP;
-
- }
- }
-while (){
- print NEWFILE;
-}
-close(NEWFILE);
-close(MENUFILE);
-
-system("cp $newFileName /usr/local/biotools/GDE/CORE/.GDEmenus")
- or die "cannot replace old menu file\n";
-
-
-
-
-
-
diff --git a/bin/readseq b/bin/readseq
deleted file mode 100755
index ba1b981..0000000
Binary files a/bin/readseq and /dev/null differ
diff --git a/bin/sho_helix b/bin/sho_helix
deleted file mode 100755
index 0c953a3..0000000
Binary files a/bin/sho_helix and /dev/null differ
diff --git a/bin/varpos b/bin/varpos
deleted file mode 100755
index 801dbf0..0000000
Binary files a/bin/varpos and /dev/null differ